Rmu_co8481489.1_g000001

Solute carrier family 35

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8481489.1
Physical Location & Seq
Forward (+)
1 .. 2200
2200 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8481489.1_g000001.1.cds

Sequence Viewer

Length: 302 bp
ccctctgtgtggttgggcttggcatagtgctcctctctgatgcaggggtagctggtggaggtggttcacaacctcttcttggagatgtcctggtcatagcaggaacaattttctttgcactgagcaatgttggtgaggagttttgtgtgaagaaaagagatcgtattgaagtagtatgcatgattggtgtatttggatttctaatattggcctttgttggctatggattggcaggctttatgctgtacacacttggtccattcgttcttcaggtcaatttccttctgatcaagtctcagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.36

Weight (kDa)

5.0

Isoelectric Point (pI)

26.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 253
AfaI GTAC 1 cut(s) 247
AfiI CCNNNNNNNGG 2 cut(s) 9, 79
AgsI TTSAA 1 cut(s) 169
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
Alw21I GWGCWC 1 cut(s) 32
AoxI GGCC 1 cut(s) 209
AspS9I GGNCC 1 cut(s) 256
AsuHPI GGTGA 1 cut(s) 145
AvaII GGWCC 1 cut(s) 256
Bbv12I GWGCWC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 91
BclI TGATCA 1 cut(s) 287
Bme1390I CCNGG 1 cut(s) 91
Bme18I GGWCC 1 cut(s) 256
BmgT120I GGNCC 1 cut(s) 256
BmrFI CCNGG 1 cut(s) 91
BmsI GCATC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 2 cut(s) 9, 79
Bse3DI GCAATG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 91
BseLI CCNNNNNNNGG 2 cut(s) 9, 79
BseMI GCAATG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 112
BseRI GAGGAG 2 cut(s) 22, 151
BshFI GGCC 1 cut(s) 211
BsiHKAI GWGCWC 1 cut(s) 32
BslI CCNNNNNNNGG 2 cut(s) 9, 79
BsnI GGCC 1 cut(s) 211
Bsp1286I GDGCHC 1 cut(s) 32
Bsp1407I TGTACA 1 cut(s) 245
Bsp143I GATC 2 cut(s) 159, 287
BspANI GGCC 1 cut(s) 211
BspCNI CTCAG 1 cut(s) 113
BsrDI GCAATG 1 cut(s) 132
BsrGI TGTACA 1 cut(s) 245
BssMI GATC 2 cut(s) 159, 287
Bst2UI CCWGG 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 80
BstAUI TGTACA 1 cut(s) 245
BstC8I GCNNGC 1 cut(s) 234
BstDEI CTNAG 2 cut(s) 121, 296
BstKTI GATC 2 cut(s) 162, 290
BstMBI GATC 2 cut(s) 159, 287
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
BsuRI GGCC 1 cut(s) 211
BtsIMutI CAGTG 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 234
Cfr13I GGNCC 1 cut(s) 256
Csp6I GTAC 1 cut(s) 246
CviAII CATG 1 cut(s) 180
CviJI RGCY 5 cut(s) 18, 52, 211, 221, 236
CviKI_1 RGCY 5 cut(s) 18, 52, 211, 221, 236
CviQI GTAC 1 cut(s) 246
DdeI CTNAG 2 cut(s) 121, 296
DpnI GATC 2 cut(s) 161, 289
DpnII GATC 2 cut(s) 159, 287
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Eco47I GGWCC 1 cut(s) 256
Eco57I CTGAAG 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 89
EcoT22I ATGCAT 1 cut(s) 181
FaeI CATG 1 cut(s) 183
FaiI YATR 6 cut(s) 25, 97, 177, 181, 224, 241
FatI CATG 1 cut(s) 179
FbaI TGATCA 1 cut(s) 287
HaeIII GGCC 1 cut(s) 211
Hin1II CATG 1 cut(s) 183
HphI GGTGA 1 cut(s) 145
Hpy166II GTNNAC 2 cut(s) 67, 248
Hpy188I TCNGA 2 cut(s) 39, 287
Hpy8I GTNNAC 2 cut(s) 67, 248
HpyAV CCTTC 1 cut(s) 292
HpyCH4V TGCA 3 cut(s) 43, 118, 179
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 2 cut(s) 121, 296
Hsp92II CATG 1 cut(s) 183
Ksp22I TGATCA 1 cut(s) 287
Kzo9I GATC 2 cut(s) 159, 287
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 7 cut(s) 29, 38, 76, 86, 103, 218, 256
LweI GCATC 1 cut(s) 30
MalI GATC 2 cut(s) 161, 289
MboI GATC 2 cut(s) 159, 287
MboII GAAGA 3 cut(s) 67, 162, 259
MhlI GDGCHC 1 cut(s) 32
MluCI AATT 2 cut(s) 107, 276
MnlI CCTC 5 cut(s) 13, 43, 52, 83, 129
Mph1103I ATGCAT 1 cut(s) 181
MspR9I CCNGG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 91
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 2 cut(s) 159, 287
NlaIII CATG 1 cut(s) 183
NsiI ATGCAT 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspPI GGNCC 1 cut(s) 256
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
Sau3AI GATC 2 cut(s) 159, 287
Sau96I GGNCC 1 cut(s) 256
ScrFI CCNGG 1 cut(s) 91
SduI GDGCHC 1 cut(s) 32
SetI ASST 4 cut(s) 54, 63, 75, 275
SfaNI GCATC 1 cut(s) 30
SinI GGWCC 1 cut(s) 256
Sse9I AATT 2 cut(s) 107, 276
SspI AATATT 1 cut(s) 206
StyD4I CCNGG 1 cut(s) 89
TasI AATT 2 cut(s) 107, 276
TatI WGTACW 1 cut(s) 245
TscAI CASTG 1 cut(s) 125
TspRI CASTG 1 cut(s) 125
VpaK11BI GGWCC 1 cut(s) 256
Zsp2I ATGCAT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.