Rmu_sc0000787.1_g000011

Solute carrier family 35 member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000787.1
Physical Location & Seq
Forward (+)
86024 .. 91472
5449 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000787.1_g000011.1.cds

Sequence Viewer

Length: 1125 bp
atgaggagtttgagagagttgtgggtggagaagacattggtcggtcttgggttgggccagtttctctcgcttttgatcacttccactggtttttcatcctcagagttggctaaaaaaggaattaatgcccctacttcgcagtctttcctgaactatgtcctcttagcaattgtctatggaagtatcatggtttaccggaggaaaccacttaaggctaaatggtattactatgttcttcttgggttggtagatgtggaggccaattttctagtggtgaaggcttatcaatacacatctataacgagtgtaatgttgctggattgttggactatcccatcggtcatgcttcttacttgggttttcctcaaaacaaaatacagatttaaaaagataactggtgtggtggcctgtgttgctggccttgtcatggttgttttctcagatgttcatgcaggcgatcgagcaggagggagcaatccccgtaaaggtgatatactagtaattgccggttctaccctgtatgctgtcactaatgtcagtgaggagtttctagtgaagaatgctgacagagttgaactcatgtccttgctgggcttttttggtgccattatcagtgctatccaaataagcattttagaacgtaacgagctcaaatccatcaagtggtcatctggagcagtatttccttttgttggattttcattggctatgttcctcttttactcattagtcccaatcttacttaagattaatgggtctacgatgttaaacctgtcattgctgacctcagacatgtgggccgtcttaattcgcatttttgcttaccatgagaaggttgattggatgtactttgtggcctttgcaatcgttgttgttgggcttgttatttattcatgggctgacaaggaagaggatcaacgctgggctgatgttgcggatgaagatgcagagagaagcaaacgttttgacgaggaagttgcttcagtaagtcgtgaccgaggaacaatggctgggacctcaaaaacaggggataacagcaaggatgaagctcctacatgctctacagaaagagaaattgttgacaacaagagcataggaagagatggacaagggaagaaatcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

374

Amino Acids

41.63

Weight (kDa)

8.54

Isoelectric Point (pI)

23.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 602
AccB7I CCANNNNNTGG 1 cut(s) 663
AccI GTMKAC 1 cut(s) 758
AciI CCGC 1 cut(s) 935
AclI AACGTT 1 cut(s) 961
AclWI GGATC 1 cut(s) 921
AcuI CTGAAG 1 cut(s) 966
AfaI GTAC 1 cut(s) 848
AfiI CCNNNNNNNGG 5 cut(s) 427, 485, 663, 692, 832
AflII CTTAAG 2 cut(s) 209, 743
AflIII ACRYGT 1 cut(s) 792
AgsI TTSAA 1 cut(s) 575
AhlI ACTAGT 1 cut(s) 496
AluBI AGCT 2 cut(s) 649, 1049
AluI AGCT 2 cut(s) 649, 1049
Alw21I GWGCWC 1 cut(s) 651
AlwI GGATC 1 cut(s) 921
AoxI GGCC 6 cut(s) 55, 258, 405, 418, 798, 855
AseI ATTAAT 2 cut(s) 123, 750
AspS9I GGNCC 3 cut(s) 55, 798, 1014
AsuHPI GGTGA 2 cut(s) 286, 500
AvaII GGWCC 1 cut(s) 1014
BanI GGYRCC 1 cut(s) 602
BanII GRGCYC 1 cut(s) 651
BbsI GAAGAC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 651
BccI CCATC 3 cut(s) 343, 665, 1097
BceAI ACGGC 1 cut(s) 785
BcgI CGANNNNNNTGC 2 cut(s) 959, 993
BclI TGATCA 1 cut(s) 75
BcuI ACTAGT 1 cut(s) 496
BfaI CTAG 3 cut(s) 269, 497, 551
BfmI CTRYAG 1 cut(s) 1062
BfrI CTTAAG 2 cut(s) 209, 743
Bme18I GGWCC 1 cut(s) 1014
BmgT120I GGNCC 3 cut(s) 55, 798, 1014
BmiI GGNNCC 2 cut(s) 604, 1015
BmsI GCATC 1 cut(s) 934
BoxI GACNNNNGTC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 38
BplI GAGNNNNNCTC 2 cut(s) 561, 593
BpmI CTGGAG 1 cut(s) 693
BsaJI CCNNGG 1 cut(s) 997
BsaWI WCCGGW 1 cut(s) 195
Bsc4I CCNNNNNNNGG 5 cut(s) 427, 485, 663, 692, 832
Bse118I RCCGGY 1 cut(s) 506
Bse1I ACTGG 3 cut(s) 58, 91, 400
Bse3DI GCAATG 1 cut(s) 776
BseDI CCNNGG 1 cut(s) 997
BseGI GGATG 4 cut(s) 95, 849, 943, 1048
BseLI CCNNNNNNNGG 5 cut(s) 427, 485, 663, 692, 832
BseMI GCAATG 1 cut(s) 776
BseMII CTCAG 3 cut(s) 114, 453, 801
BseNI ACTGG 3 cut(s) 58, 91, 400
BseRI GAGGAG 2 cut(s) 19, 557
BseYI CCCAGC 3 cut(s) 589, 921, 1010
Bsh1285I CGRYCG 1 cut(s) 460
BshFI GGCC 6 cut(s) 57, 260, 407, 420, 800, 857
BshNI GGYRCC 1 cut(s) 602
BsiEI CGRYCG 1 cut(s) 460
BsiHKAI GWGCWC 1 cut(s) 651
BsiSI CCGG 2 cut(s) 196, 507
BslFI GGGAC 2 cut(s) 716, 1027
BslI CCNNNNNNNGG 5 cut(s) 427, 485, 663, 692, 832
BsmFI GGGAC 2 cut(s) 716, 1027
BsmI GAATGC 1 cut(s) 565
BsnI GGCC 6 cut(s) 57, 260, 407, 420, 800, 857
Bsp1286I GDGCHC 1 cut(s) 651
Bsp143I GATC 3 cut(s) 75, 457, 913
BspACI CCGC 1 cut(s) 935
BspANI GGCC 6 cut(s) 57, 260, 407, 420, 800, 857
BspCNI CTCAG 3 cut(s) 113, 452, 800
BspHI TCATGA 1 cut(s) 1121
BspLI GGNNCC 2 cut(s) 604, 1015
BspPI GGATC 1 cut(s) 921
BspT107I GGYRCC 1 cut(s) 602
BspTI CTTAAG 2 cut(s) 209, 743
BsrDI GCAATG 1 cut(s) 776
BsrFI RCCGGY 1 cut(s) 506
BsrI ACTGG 3 cut(s) 58, 91, 400
BssAI RCCGGY 1 cut(s) 506
BssECI CCNNGG 1 cut(s) 997
BssMI GATC 3 cut(s) 75, 457, 913
Bst6I CTCTTC 2 cut(s) 903, 1093
BstAFI CTTAAG 2 cut(s) 209, 743
BstC8I GCNNGC 2 cut(s) 418, 454
BstDEI CTNAG 4 cut(s) 100, 163, 439, 787
BstF5I GGATG 4 cut(s) 95, 849, 943, 1048
BstKTI GATC 3 cut(s) 78, 460, 916
BstMBI GATC 3 cut(s) 75, 457, 913
BstMCI CGRYCG 1 cut(s) 460
BstMWI GCNNNNNNNGC 2 cut(s) 413, 932
BstNSI RCATGY 2 cut(s) 796, 1059
BstPAI GACNNNNGTC 1 cut(s) 38
BstSFI CTRYAG 1 cut(s) 1062
BstV2I GAAGAC 1 cut(s) 38
BsuRI GGCC 6 cut(s) 57, 260, 407, 420, 800, 857
BtsCI GGATG 4 cut(s) 95, 849, 943, 1048
BtsIMutI CAGTG 3 cut(s) 84, 544, 619
Cac8I GCNNGC 2 cut(s) 418, 454
CciI TCATGA 1 cut(s) 1121
Cfr10I RCCGGY 1 cut(s) 506
Cfr13I GGNCC 3 cut(s) 55, 798, 1014
Csp6I GTAC 1 cut(s) 847
CviQI GTAC 1 cut(s) 847
DdeI CTNAG 4 cut(s) 100, 163, 439, 787
DpnI GATC 3 cut(s) 77, 459, 915
DpnII GATC 3 cut(s) 75, 457, 913
DraI TTTAAA 1 cut(s) 385
Eam1104I CTCTTC 2 cut(s) 903, 1093
EarI CTCTTC 2 cut(s) 903, 1093
Ecl136II GAGCTC 1 cut(s) 649
Eco24I GRGCYC 1 cut(s) 651
Eco47I GGWCC 1 cut(s) 1014
Eco53kI GAGCTC 1 cut(s) 649
Eco57I CTGAAG 1 cut(s) 966
EcoICRI GAGCTC 1 cut(s) 649
EcoO109I RGGNCCY 1 cut(s) 1014
EcoT38I GRGCYC 1 cut(s) 651
FaqI GGGAC 2 cut(s) 716, 1027
FbaI TGATCA 1 cut(s) 75
FblI GTMKAC 1 cut(s) 758
FokI GGATG 4 cut(s) 82, 856, 950, 1055
FriOI GRGCYC 1 cut(s) 651
FspBI CTAG 3 cut(s) 269, 497, 551
GsaI CCCAGC 3 cut(s) 593, 925, 1014
GsuI CTGGAG 1 cut(s) 693
HaeIII GGCC 6 cut(s) 57, 260, 407, 420, 800, 857
HapII CCGG 2 cut(s) 196, 507
HincII GTYRAC 1 cut(s) 1081
HindII GTYRAC 1 cut(s) 1081
HpaII CCGG 2 cut(s) 196, 507
HphI GGTGA 2 cut(s) 286, 500
Hpy166II GTNNAC 3 cut(s) 193, 759, 1081
Hpy188I TCNGA 3 cut(s) 103, 442, 790
Hpy188III TCNNGA 4 cut(s) 148, 672, 992, 1122
Hpy8I GTNNAC 3 cut(s) 193, 759, 1081
HpyAV CCTTC 2 cut(s) 271, 826
HpyCH4IV ACGT 2 cut(s) 640, 961
HpyCH4V TGCA 3 cut(s) 452, 863, 947
HpyF10VI GCNNNNNNNGC 2 cut(s) 413, 932
HpyF3I CTNAG 4 cut(s) 100, 163, 439, 787
HpySE526I ACGT 2 cut(s) 640, 961
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 3 cut(s) 75, 457, 913
LmnI GCTCC 3 cut(s) 471, 674, 1054
LweI GCATC 1 cut(s) 934
MaeI CTAG 3 cut(s) 269, 497, 551
MaeII ACGT 2 cut(s) 640, 961
MaeIII GTNAC 3 cut(s) 526, 641, 992
MalI GATC 3 cut(s) 77, 459, 915
MboI GATC 3 cut(s) 75, 457, 913
MboII GAAGA 6 cut(s) 43, 227, 568, 920, 953, 1110
MfeI CAATTG 1 cut(s) 168
MhlI GDGCHC 1 cut(s) 651
MluCI AATT 6 cut(s) 120, 168, 262, 501, 807, 1074
MmeI TCCRAC 2 cut(s) 305, 673
MseI TTAA 7 cut(s) 123, 210, 384, 744, 750, 767, 806
MspCI CTTAAG 2 cut(s) 209, 743
MspI CCGG 2 cut(s) 196, 507
MunI CAATTG 1 cut(s) 168
Mva1269I GAATGC 1 cut(s) 565
MwoI GCNNNNNNNGC 2 cut(s) 413, 932
NdeII GATC 3 cut(s) 75, 457, 913
NlaIV GGNNCC 2 cut(s) 604, 1015
NmuCI GTSAC 2 cut(s) 526, 992
NspI RCATGY 2 cut(s) 796, 1059
PagI TCATGA 1 cut(s) 1121
PciI ACATGT 1 cut(s) 792
PctI GAATGC 1 cut(s) 565
PflMI CCANNNNNTGG 1 cut(s) 663
Ple19I CGATCG 1 cut(s) 460
PpuMI RGGWCCY 1 cut(s) 1014
PscI ACATGT 1 cut(s) 792
PshAI GACNNNNGTC 1 cut(s) 38
PshBI ATTAAT 2 cut(s) 123, 750
Psp124BI GAGCTC 1 cut(s) 651
Psp1406I AACGTT 1 cut(s) 961
Psp5II RGGWCCY 1 cut(s) 1014
PspFI CCCAGC 3 cut(s) 589, 921, 1010
PspN4I GGNNCC 2 cut(s) 604, 1015
PspPI GGNCC 3 cut(s) 55, 798, 1014
PspPPI RGGWCCY 1 cut(s) 1014
PvuI CGATCG 1 cut(s) 460
RsaI GTAC 1 cut(s) 848
RsaNI GTAC 1 cut(s) 847
SacI GAGCTC 1 cut(s) 651
SaqAI TTAA 7 cut(s) 123, 210, 384, 744, 750, 767, 806
Sau3AI GATC 3 cut(s) 75, 457, 913
Sau96I GGNCC 3 cut(s) 55, 798, 1014
SduI GDGCHC 1 cut(s) 651
SetI ASST 9 cut(s) 490, 643, 651, 774, 788, 837, 964, 1019, 1051
SfaNI GCATC 1 cut(s) 934
SfcI CTRYAG 1 cut(s) 1062
SinI GGWCC 1 cut(s) 1014
SmlI CTYRAG 2 cut(s) 209, 743
SmoI CTYRAG 2 cut(s) 209, 743
SpeI ACTAGT 1 cut(s) 496
Sse9I AATT 6 cut(s) 120, 168, 262, 501, 807, 1074
SsiI CCGC 1 cut(s) 935
SspMI CTAG 3 cut(s) 269, 497, 551
SstI GAGCTC 1 cut(s) 651
TaiI ACGT 2 cut(s) 643, 964
TaqI TCGA 1 cut(s) 460
TaqII GACCGA 3 cut(s) 32, 328, 1011
TasI AATT 6 cut(s) 120, 168, 262, 501, 807, 1074
TatI WGTACW 1 cut(s) 846
Tru1I TTAA 7 cut(s) 123, 210, 384, 744, 750, 767, 806
Tru9I TTAA 7 cut(s) 123, 210, 384, 744, 750, 767, 806
TscAI CASTG 3 cut(s) 91, 544, 619
TseFI GTSAC 2 cut(s) 526, 992
Tsp45I GTSAC 2 cut(s) 526, 992
TspDTI ATGAA 6 cut(s) 84, 437, 690, 882, 954, 1059
TspRI CASTG 3 cut(s) 91, 544, 619
Van91I CCANNNNNTGG 1 cut(s) 663
Vha464I CTTAAG 2 cut(s) 209, 743
VpaK11BI GGWCC 1 cut(s) 1014
VspI ATTAAT 2 cut(s) 123, 750
XceI RCATGY 2 cut(s) 796, 1059
XcmI CCANNNNNNNNNTGG 1 cut(s) 268
XmiI GTMKAC 1 cut(s) 758
XspI CTAG 3 cut(s) 269, 497, 551
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.