Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000332.1

Orthogroup ID

OG0001952

Physical Location & Seq

Genomic Coordinates Forward (+)

45320 .. 47659

Gene Structure 2340 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000332.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2340 bp

atgttcaagctatctcctcgcaggaacccgagatctaaaggtttcaaggtgaagcatgtactacaaatatgtcttttggtgggtgtctgcatctggctagtttaccaagtcaagcagtctcaagtcaagaaatcacagttggctgcaagcataaaagatggcaatggaattgtaaatttaggaagaaaggccctcaaccctcttcgggaggaaactgttgttgaagatgcaaggcacaaggaggaggaggaagacgaagaaaacaggaatgtggaagagccaaacaagcctgtagagatcgataatgttggaggaggcagtggagaagaccagataaatgaaaatgatcagcctaaagttgaagaaacgagggatgatcatgttgattcagtagaaggagataaagaaacggaagtgacaagagagactattaatgaggagggcactgtgaatgaagatgaacagatcaaggatgatgtggatggaaacacgaagaatgaagatgtcaaagagaatgagactgaggagagcaatgaaagggtaactgaagaggtcaaagagaaagaaagtgaagaggtgaaggagactgaagtgaccaaagaaaaagaaggtcaagaggtgaaggagaatgaagagaccaaggaggaaggaacatcggaggagagtcaaggggaggtcaataaggaggagggggaagagcacaatgagacagataaagaaaaggaggcagaagagaaggaaggtgataagattgaacaggtgattttagctgatgaccggcttcaagatggaggtgaaaaacataatgaggaggcaagagaagagcattacaaggctgatgatgcttccagtgctgtggctcatgaaactcaaaatgtatcagccaataatgaacaaggtggttcagaaaacactaatgaatcagagcagtcagttgacaaagaaaagcaggagtttcagcgggagaacaatgcaaatagcactgtagtggataaagaccaaaacaagtcggtctcaaacagggaagcagtggaaagcggtgaaaagaatgatactgataatgctaccgtaaccgaagtggtttctgagggtaatccttctgaaacagagaatggttctaaatccagttcaacactggccacagaatcattagagcagcagcaagtggacaccaaaaaagatgagtctgctcagcaaactgttgtcacagagcacactgagagatctgatgtagctgctaacggtgggcaacaagactctggcacaacagcttccaccacaactgagaagggagatacaactaatggagaatccaaaaaagatgactccgctcagcaaaatgttgtcacagagcaaactgagagatctgatgtagctgctaacagtgagcaacaagactctggcacaacagcttccaccacaactcagaagggagatacaactaatggagaatccacagatacttctactaattctgaatcagttgtgacagataatcagattgtcaactccaatacatctacagaaaaagagagtggttctgcaccttcagacatgaacattgttcaaaagacaaatagtgacactgtagaagaaggaacacaagaaagtatacttacgcagaaaacaaatgacaacgtagataatggtgcagggaaacaagttgattcttctaattctacagaacagcaagagaaagatgcatcctcaagcacagataacaaatctgatgcaggccagaatgaaaatgacagtggtgttcagaacaacacaaacgacaatgcaaatggcaatggcaatgcggatgcacaccatggagaatcaggtgactcttccaattcttctgtatcacaagagaaagaggcatctcaaaacacagatagtaatgctgattcagaacagaaagagaatgagaatgttgttcaaagcaatactgatgacaatgcagatgggggccaaaaggaatcagttaatacttcagtattctcagacaccaatgctgagacgggggataatcaaaaggagaatgttgctcagagcaatgcaaatgagaatgtggtccagagcaacacaaatgagaatgtcgttcagagcaacgcgaatgagaatgtcgttcagagcaacgcaaaagagaatgaaggtgcaggcggagaagaatctggcaatgctcagaaggagaatgaagcttcaacaagcacaaatgacaacactgaggcacagaatgtcaatgttgattcttcaaattcttcgatccctgaagaagagaaaaaggctcgtatagacctggacactttgccagaaagcaaagttgaagttcacaacaatgatgctgcagagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

779

Amino Acids

84.58

Weight (kDa)

4.24

Isoelectric Point (pI)

44.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001952)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G22795 AT2G22795 AT2G22795 AT4G37820 AT4G37820
fragaria_vesca	FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_5g33410 FvH4_5g33410
malus_domestica	MD02G1193800.v1.1 MD15G1395300.v1.1
prunus_persica	Prupe.1G544100_v2.0.a1 Prupe.1G544100_v2.0.a1 Prupe.6G213200_v2.0.a1 Prupe.6G213200_v2.0.a1
pyrus_communis	pycom02g15770 pycom02g15780 pycom15g26690 pycom15g35590
rosa_chinensis	RchiOBHm_Chr2g0109401 RchiOBHm_Chr7g0232141
rosa_laevigata	RLG00000001388 RLG00000017734
rosa_multiflora	Rmu_sc0000332.1_g000012 Rmu_sc0000616.1_g000014 Rmu_sc0026699.1_g000001
rosa_roxburghii	Rroxscaffold_2G00134270 Rroxscaffold_3G00228750
rosa_rugosa	Rorug02G0159600 Rorug02G0159700 Rorug07G0269800
rosa_samantha	Rh2AG211700 Rh2BG222100 Rh2CG213800 Rh2DG217300 Rh7AG424300 Rh7BG398400 Rh7CG444600 Rh7DG416300
rosa_wichuraiana	Rw7G035080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	1331
AccI	GTMKAC	1 cut(s)	1612
AccII	CGCG	1 cut(s)	2099
AciI	CCGC	5 cut(s)	961, 1038, 1329, 1802, 2148
AclWI	GGATC	1 cut(s)	2245
AcoI	YGGCCR	1 cut(s)	1137
AcsI	RAATTY	2 cut(s)	175, 2242
AcuI	CTGAAG	5 cut(s)	567, 609, 1533, 1962, 2277
AfaI	GTAC	1 cut(s)	60
AfiI	CCNNNNNNNGG	1 cut(s)	205
AjnI	CCWGG	1 cut(s)	2283
AjuI	GAANNNNNNNTTGG	2 cut(s)	122, 154
AleI	CACNNNNGTG	1 cut(s)	986
AluBI	AGCT	7 cut(s)	10, 770, 1235, 1271, 1376, 1412, 2186
AluI	AGCT	7 cut(s)	10, 770, 1235, 1271, 1376, 1412, 2186
Alw21I	GWGCWC	2 cut(s)	702, 1215
Alw26I	GTCTC	8 cut(s)	123, 419, 512, 578, 629, 701, 1018, 1997
AlwI	GGATC	1 cut(s)	2245
Ama87I	CYCGRG	1 cut(s)	28
AoxI	GGCC	4 cut(s)	189, 1137, 1735, 1954
ApeKI	GCWGC	6 cut(s)	143, 1156, 1159, 1235, 1376, 2330
ApoI	RAATTY	2 cut(s)	175, 2242
AseI	ATTAAT	1 cut(s)	432
AspS9I	GGNCC	3 cut(s)	190, 1954, 2059
AsuHPI	GGTGA	8 cut(s)	61, 589, 631, 755, 772, 806, 1052, 1838
AvaI	CYCGRG	1 cut(s)	28
AvaII	GGWCC	1 cut(s)	2059
BaeGI	GKGCMC	1 cut(s)	446
BalI	TGGCCA	1 cut(s)	1139
BbsI	GAAGAC	2 cut(s)	258, 333
Bbv12I	GWGCWC	2 cut(s)	702, 1215
BbvI	GCAGC	6 cut(s)	130, 1168, 1171, 1222, 1363, 2317
BccI	CCATC	4 cut(s)	152, 476, 782, 1943
BciT130I	CCWGG	1 cut(s)	2285
BclI	TGATCA	2 cut(s)	346, 376
BcoDI	GTCTC	8 cut(s)	123, 419, 512, 578, 629, 701, 1018, 1997
BfaI	CTAG	1 cut(s)	98
BfmI	CTRYAG	6 cut(s)	291, 984, 1521, 1587, 1680, 2331
BglII	AGATCT	3 cut(s)	32, 1223, 1364
BisI	GCNGC	6 cut(s)	144, 1157, 1160, 1236, 1377, 2331
BlpI	GCTNAGC	2 cut(s)	1191, 1332
BlsI	GCNGC	6 cut(s)	145, 1158, 1161, 1237, 1378, 2332
Bme1390I	CCNGG	1 cut(s)	2285
Bme18I	GGWCC	1 cut(s)	2059
BmeT110I	CYCGRG	1 cut(s)	28
BmgT120I	GGNCC	3 cut(s)	190, 1954, 2059
BmiI	GGNNCC	2 cut(s)	26, 1955
BmrFI	CCNGG	1 cut(s)	2285
BmsI	GCATC	9 cut(s)	99, 217, 832, 1690, 1712, 1720, 1795, 1874, 2317
BpiI	GAAGAC	2 cut(s)	258, 333
Bpu1102I	GCTNAGC	2 cut(s)	1191, 1332
BpuEI	CTTGAG	2 cut(s)	105, 1693
Bsa29I	ATCGAT	1 cut(s)	300
BsaI	GGTCTC	2 cut(s)	629, 1018
BsaJI	CCNNGG	2 cut(s)	639, 1813
Bsc4I	CCNNNNNNNGG	1 cut(s)	205
Bse118I	RCCGGY	1 cut(s)	777
Bse1I	ACTGG	3 cut(s)	849, 1125, 1140
Bse3DI	GCAATG	6 cut(s)	169, 538, 1798, 1804, 2047, 2170
BseBI	CCWGG	1 cut(s)	2285
BseCI	ATCGAT	1 cut(s)	300
BseDI	CCNNGG	2 cut(s)	639, 1813
BseGI	GGATG	5 cut(s)	379, 478, 487, 1703, 1810
BseLI	CCNNNNNNNGG	1 cut(s)	205
BseMI	GCAATG	6 cut(s)	169, 538, 1798, 1804, 2047, 2170
BseNI	ACTGG	3 cut(s)	849, 1125, 1140
BseRI	GAGGAG	9 cut(s)	6, 257, 260, 327, 452, 539, 674, 701, 824
BseSI	GKGCMC	1 cut(s)	446
BseXI	GCAGC	6 cut(s)	130, 1168, 1171, 1222, 1363, 2317
BsgI	GTGCAG	3 cut(s)	1527, 1671, 2163
Bsh1236I	CGCG	1 cut(s)	2099
BshFI	GGCC	4 cut(s)	191, 1139, 1737, 1956
BshVI	ATCGAT	1 cut(s)	300
BsiHKAI	GWGCWC	2 cut(s)	702, 1215
BsiHKCI	CYCGRG	1 cut(s)	28
BsiSI	CCGG	1 cut(s)	778
BslI	CCNNNNNNNGG	1 cut(s)	205
BsmAI	GTCTC	8 cut(s)	123, 419, 512, 578, 629, 701, 1018, 1997
BsmBI	CGTCTC	1 cut(s)	1997
BsnI	GGCC	4 cut(s)	191, 1139, 1737, 1956
Bso31I	GGTCTC	2 cut(s)	629, 1018
BsoBI	CYCGRG	1 cut(s)	28
Bsp1286I	GDGCHC	3 cut(s)	446, 702, 1215
Bsp143I	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
Bsp1720I	GCTNAGC	2 cut(s)	1191, 1332
Bsp19I	CCATGG	1 cut(s)	1813
BspACI	CCGC	5 cut(s)	961, 1038, 1329, 1802, 2148
BspANI	GGCC	4 cut(s)	191, 1139, 1737, 1956
BspDI	ATCGAT	1 cut(s)	300
BspFNI	CGCG	1 cut(s)	2099
BspHI	TCATGA	1 cut(s)	862
BspLI	GGNNCC	2 cut(s)	26, 1955
BspMAI	CTGCAG	1 cut(s)	2335
BspPI	GGATC	1 cut(s)	2245
BspQI	GCTCTTC	3 cut(s)	270, 690, 816
BspTNI	GGTCTC	2 cut(s)	629, 1018
BsrBI	CCGCTC	1 cut(s)	1331
BsrDI	GCAATG	6 cut(s)	169, 538, 1798, 1804, 2047, 2170
BsrFI	RCCGGY	1 cut(s)	777
BsrI	ACTGG	3 cut(s)	849, 1125, 1140
BssAI	RCCGGY	1 cut(s)	777
BssECI	CCNNGG	2 cut(s)	639, 1813
BssMI	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
BssNAI	GTATAC	1 cut(s)	1613
BssT1I	CCWWGG	2 cut(s)	639, 1813
Bst1107I	GTATAC	1 cut(s)	1613
Bst2UI	CCWGG	1 cut(s)	2285
BstC8I	GCNNGC	3 cut(s)	148, 1735, 2146
BstDSI	CCRYGG	1 cut(s)	1813
BstF5I	GGATG	5 cut(s)	379, 478, 487, 1703, 1810
BstFNI	CGCG	1 cut(s)	2099
BstKTI	GATC	8 cut(s)	35, 300, 349, 379, 468, 1226, 1367, 2253
BstMAI	GTCTC	8 cut(s)	123, 419, 512, 578, 629, 701, 1018, 1997
BstMBI	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
BstMWI	GCNNNNNNNGC	3 cut(s)	286, 842, 851
BstNI	CCWGG	1 cut(s)	2285
BstNSI	RCATGY	1 cut(s)	59
BstSCI	CCNGG	1 cut(s)	2283
BstSFI	CTRYAG	6 cut(s)	291, 984, 1521, 1587, 1680, 2331
BstSLI	GKGCMC	1 cut(s)	446
BstUI	CGCG	1 cut(s)	2099
BstV1I	GCAGC	6 cut(s)	130, 1168, 1171, 1222, 1363, 2317
BstV2I	GAAGAC	2 cut(s)	258, 333
BstX2I	RGATCY	3 cut(s)	32, 1223, 1364
BstXI	CCANNNNNNTGG	1 cut(s)	856
BstYI	RGATCY	3 cut(s)	32, 1223, 1364
BstZ17I	GTATAC	1 cut(s)	1613
Bsu15I	ATCGAT	1 cut(s)	300
BsuRI	GGCC	4 cut(s)	191, 1139, 1737, 1956
BsuTUI	ATCGAT	1 cut(s)	300
BtgI	CCRYGG	1 cut(s)	1813
BtsCI	GGATG	5 cut(s)	379, 478, 487, 1703, 1810
BtsI	GCAGTG	2 cut(s)	325, 1035
Cac8I	GCNNGC	3 cut(s)	148, 1735, 2146
CciI	TCATGA	1 cut(s)	862
Cfr10I	RCCGGY	1 cut(s)	777
Cfr13I	GGNCC	3 cut(s)	190, 1954, 2059
ClaI	ATCGAT	1 cut(s)	300
Csp6I	GTAC	1 cut(s)	59
CviAII	CATG	5 cut(s)	56, 380, 863, 1555, 1814
CviQI	GTAC	1 cut(s)	59
DpnI	GATC	8 cut(s)	34, 299, 348, 378, 467, 1225, 1366, 2252
DpnII	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
EaeI	YGGCCR	1 cut(s)	1137
EciI	GGCGGA	1 cut(s)	2163
Eco130I	CCWWGG	2 cut(s)	639, 1813
Eco31I	GGTCTC	2 cut(s)	629, 1018
Eco47I	GGWCC	1 cut(s)	2059
Eco57I	CTGAAG	5 cut(s)	567, 609, 1533, 1962, 2277
Eco88I	CYCGRG	1 cut(s)	28
EcoO109I	RGGNCCY	1 cut(s)	190
EcoRII	CCWGG	1 cut(s)	2283
EcoT14I	CCWWGG	2 cut(s)	639, 1813
EcoT22I	ATGCAT	1 cut(s)	1705
ErhI	CCWWGG	2 cut(s)	639, 1813
Esp3I	CGTCTC	1 cut(s)	1997
FaeI	CATG	5 cut(s)	59, 383, 866, 1558, 1817
FatI	CATG	5 cut(s)	55, 379, 862, 1554, 1813
FauI	CCCGC	1 cut(s)	954
FbaI	TGATCA	2 cut(s)	346, 376
FblI	GTMKAC	1 cut(s)	1612
Fnu4HI	GCNGC	6 cut(s)	144, 1157, 1160, 1236, 1377, 2331
FokI	GGATG	5 cut(s)	386, 485, 494, 1690, 1817
Fsp4HI	GCNGC	6 cut(s)	144, 1157, 1160, 1236, 1377, 2331
FspBI	CTAG	1 cut(s)	98
GluI	GCNGC	6 cut(s)	144, 1157, 1160, 1236, 1377, 2331
HaeIII	GGCC	4 cut(s)	191, 1139, 1737, 1956
HapII	CCGG	1 cut(s)	778
Hin1II	CATG	5 cut(s)	59, 383, 866, 1558, 1817
HincII	GTYRAC	2 cut(s)	937, 1507
HindII	GTYRAC	2 cut(s)	937, 1507
HindIII	AAGCTT	1 cut(s)	2184
HpaII	CCGG	1 cut(s)	778
HphI	GGTGA	8 cut(s)	61, 589, 631, 755, 772, 806, 1052, 1838
Hpy166II	GTNNAC	6 cut(s)	103, 937, 1168, 1507, 1613, 2317
Hpy188III	TCNNGA	6 cut(s)	127, 206, 614, 785, 863, 2062
Hpy8I	GTNNAC	6 cut(s)	103, 937, 1168, 1507, 1613, 2317
HpyCH4IV	ACGT	1 cut(s)	1638
HpyF10VI	GCNNNNNNNGC	3 cut(s)	286, 842, 851
HpySE526I	ACGT	1 cut(s)	1638
Hsp92II	CATG	5 cut(s)	59, 383, 866, 1558, 1817
Ksp22I	TGATCA	2 cut(s)	346, 376
Kzo9I	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
LguI	GCTCTTC	3 cut(s)	270, 690, 816
Lsp1109I	GCAGC	6 cut(s)	130, 1168, 1171, 1222, 1363, 2317
LweI	GCATC	9 cut(s)	99, 217, 832, 1690, 1712, 1720, 1795, 1874, 2317
MaeI	CTAG	1 cut(s)	98
MaeII	ACGT	1 cut(s)	1638
MaeIII	GTNAC	9 cut(s)	415, 541, 592, 1069, 1204, 1345, 1486, 1580, 1826
MalI	GATC	8 cut(s)	34, 299, 348, 378, 467, 1225, 1366, 2252
MbiI	CCGCTC	1 cut(s)	1331
MboI	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
MflI	RGATCY	3 cut(s)	32, 1223, 1364
MhlI	GDGCHC	3 cut(s)	446, 702, 1215
MlsI	TGGCCA	1 cut(s)	1139
MluCI	AATT	6 cut(s)	168, 175, 1471, 1675, 1837, 2242
MluNI	TGGCCA	1 cut(s)	1139
MlyI	GAGTC	6 cut(s)	673, 1193, 1250, 1319, 1391, 1823
MmeI	TCCRAC	1 cut(s)	289
Mox20I	TGGCCA	1 cut(s)	1139
Mph1103I	ATGCAT	1 cut(s)	1705
MscI	TGGCCA	1 cut(s)	1139
MseI	TTAA	2 cut(s)	432, 1971
MslI	CAYNNNNRTG	2 cut(s)	986, 2322
Msp20I	TGGCCA	1 cut(s)	1139
MspA1I	CMGCKG	1 cut(s)	961
MspI	CCGG	1 cut(s)	778
MspR9I	CCNGG	1 cut(s)	2285
MvaI	CCWGG	1 cut(s)	2285
MvnI	CGCG	1 cut(s)	2099
MwoI	GCNNNNNNNGC	3 cut(s)	286, 842, 851
NcoI	CCATGG	1 cut(s)	1813
NdeII	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
NlaIII	CATG	5 cut(s)	59, 383, 866, 1558, 1817
NlaIV	GGNNCC	2 cut(s)	26, 1955
NmuCI	GTSAC	7 cut(s)	415, 592, 1204, 1345, 1486, 1580, 1826
NsiI	ATGCAT	1 cut(s)	1705
NspI	RCATGY	1 cut(s)	59
OliI	CACNNNNGTG	1 cut(s)	986
PagI	TCATGA	1 cut(s)	862
PciSI	GCTCTTC	3 cut(s)	270, 690, 816
PkrI	GCNGC	6 cut(s)	145, 1158, 1161, 1237, 1378, 2332
PleI	GAGTC	6 cut(s)	672, 1192, 1250, 1319, 1391, 1823
PpsI	GAGTC	6 cut(s)	672, 1192, 1250, 1319, 1391, 1823
PshBI	ATTAAT	1 cut(s)	432
Psp6I	CCWGG	1 cut(s)	2283
PspGI	CCWGG	1 cut(s)	2283
PspN4I	GGNNCC	2 cut(s)	26, 1955
PspPI	GGNCC	3 cut(s)	190, 1954, 2059
PstI	CTGCAG	1 cut(s)	2335
PsuI	RGATCY	3 cut(s)	32, 1223, 1364
RsaI	GTAC	1 cut(s)	60
RsaNI	GTAC	1 cut(s)	59
RseI	CAYNNNNRTG	2 cut(s)	986, 2322
SapI	GCTCTTC	3 cut(s)	270, 690, 816
SaqAI	TTAA	2 cut(s)	432, 1971
SatI	GCNGC	6 cut(s)	144, 1157, 1160, 1236, 1377, 2331
Sau3AI	GATC	8 cut(s)	32, 297, 346, 376, 465, 1223, 1364, 2250
Sau96I	GGNCC	3 cut(s)	190, 1954, 2059
SchI	GAGTC	6 cut(s)	673, 1193, 1250, 1319, 1391, 1823
ScrFI	CCNGG	1 cut(s)	2285
SduI	GDGCHC	3 cut(s)	446, 702, 1215
SfaNI	GCATC	9 cut(s)	99, 217, 832, 1690, 1712, 1720, 1795, 1874, 2317
SfcI	CTRYAG	6 cut(s)	291, 984, 1521, 1587, 1680, 2331
SinI	GGWCC	1 cut(s)	2059
SmiMI	CAYNNNNRTG	2 cut(s)	986, 2322
SmlI	CTYRAG	2 cut(s)	120, 1708
SmoI	CTYRAG	2 cut(s)	120, 1708
Sse9I	AATT	6 cut(s)	168, 175, 1471, 1675, 1837, 2242
SsiI	CCGC	5 cut(s)	961, 1038, 1329, 1802, 2148
SspMI	CTAG	1 cut(s)	98
StyD4I	CCNGG	1 cut(s)	2283
StyI	CCWWGG	2 cut(s)	639, 1813
TaiI	ACGT	1 cut(s)	1641
TaqI	TCGA	2 cut(s)	300, 2249
TaqII	GACCGA	1 cut(s)	1000
TasI	AATT	6 cut(s)	168, 175, 1471, 1675, 1837, 2242
TatI	WGTACW	1 cut(s)	58
Tru1I	TTAA	2 cut(s)	432, 1971
Tru9I	TTAA	2 cut(s)	432, 1971
TseFI	GTSAC	7 cut(s)	415, 592, 1204, 1345, 1486, 1580, 1826
TseI	GCWGC	6 cut(s)	143, 1156, 1159, 1235, 1376, 2330
Tsp45I	GTSAC	7 cut(s)	415, 592, 1204, 1345, 1486, 1580, 1826
TspGWI	ACGGA	1 cut(s)	425
VpaK11BI	GGWCC	1 cut(s)	2059
VspI	ATTAAT	1 cut(s)	432
XapI	RAATTY	2 cut(s)	175, 2242
XceI	RCATGY	1 cut(s)	59
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1132
XmiI	GTMKAC	1 cut(s)	1612
XspI	CTAG	1 cut(s)	98
Zsp2I	ATGCAT	1 cut(s)	1705

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.