Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026699.1

Orthogroup ID

OG0001952

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1803

Gene Structure 1803 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026699.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1741 bp

atcggaggagagtcaaggggaggtcaataaggaggagggggaagagcacaatgagacagataaagaaaaggaggcagaagaaaaggaaggtgataagattgaacaggtgattttagctgatgatcggcttcaagatggaggtgaaaaacataatgaggaggcaagagaagagcattacaaggctgatgatgcttccagtgctgtggctcatgaaactcaaaatgtatcagccaataatgaacaaggtggttcagaaaacactaaagaatcagagcagtcagttgacaaagaaaagcgggagtttcagcgggagaacaatgcaaatagcactgtagtggataaagaccaaaacaagtcggtctcaaacagggaagcagtggaaagcagtgaaaagaatgatactaataatgctacagtaaccgaagtggtttctgagggtaatccttctgaaacagagaatggttctaaatccagttcaacactggccacagaatcattagagcagcagcaagtggacaccaaaaaagatgagtctgctcagcaaactgttgtcacagagcacactgagagatctgatgtagctgctaacagtgggcaacaagactctggaacaacagcttccaccacaactgagaagggagatacaactaatggagaatccaaaaaagatgactccactcagcaaaatgttgtcacagagcaaaccgagagatctgatgtagctgctaacagtgagcaacaagactctggcacaacagcttccaccacaactcagaagggagatacaactaatggagaatccacagatacttctactaattctgaatcagttgtgacagataatcagattgtcaactccaatacatctacagaaaaagagagtggttctgcatcttcagacatgaacattgttcaaaagacaaatagtgacactgtggaagaaggaacacaagaaagtatactaatgcagaaaacaaatgacaacgtagataatggtgcagggcaacaagttgattcttctaattctacagaacagcaagagaaagatgcatcctcaagcacagataacaaatctgatgcaggccagaatgaaaatgacagtggtgttcagaacaacacaaacgacaatgcaaatggcaatggcaatgcggatgcacaccatggagaatcaggtgactcttccaattcttctgtatcacaagagaaagaggcatctcaaaacacagatagtaatgctgattcagaacagaaagagaatgagaatgttgttcaaagcaatactgatgacaatgcagatgggggccaaaaggaatcagttaatacttcagtattctcagacaccaatgctgagactggggataatcaaaaggagaatgtcgctcagagcaacgcaaatgagaatgtggtccagagcaacacaaatgagaatgtcgttcagagcaacgcgaatgagaatgtcggtcacagcaacgcgaatgagaatgtcggtcagagcaccgcaaatgagaatgtcgttcagagcaacacaaaagagaatgaaggtgcaggcggagaagaatctggcaatgctcagaaggagaatgaagcttcaacaagcacaaatgacaacactgaggcacagaatgtcaatgttgattcttcaaattcttcgatccctgaagaagagaaaaaggctcgtatagacctggacactttgccagaaagcaaagttgaagttcacaacaatgatgctgcagagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

579

Amino Acids

61.76

Weight (kDa)

4.13

Isoelectric Point (pI)

40.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001952)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G22795 AT2G22795 AT2G22795 AT4G37820 AT4G37820
fragaria_vesca	FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_1g18591 FvH4_5g33410 FvH4_5g33410
malus_domestica	MD02G1193800.v1.1 MD15G1395300.v1.1
prunus_persica	Prupe.1G544100_v2.0.a1 Prupe.1G544100_v2.0.a1 Prupe.6G213200_v2.0.a1 Prupe.6G213200_v2.0.a1
pyrus_communis	pycom02g15770 pycom02g15780 pycom15g26690 pycom15g35590
rosa_chinensis	RchiOBHm_Chr2g0109401 RchiOBHm_Chr7g0232141
rosa_laevigata	RLG00000001388 RLG00000017734
rosa_multiflora	Rmu_sc0000332.1_g000012 Rmu_sc0000616.1_g000014 Rmu_sc0026699.1_g000001
rosa_roxburghii	Rroxscaffold_2G00134270 Rroxscaffold_3G00228750
rosa_rugosa	Rorug02G0159600 Rorug02G0159700 Rorug07G0269800
rosa_samantha	Rh2AG211700 Rh2BG222100 Rh2CG213800 Rh2DG217300 Rh7AG424300 Rh7BG398400 Rh7CG444600 Rh7DG416300
rosa_wichuraiana	Rw7G035080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	959
AccII	CGCG	2 cut(s)	1446, 1473
AciI	CCGC	5 cut(s)	296, 308, 1149, 1498, 1549
AclWI	GGATC	1 cut(s)	1646
AcoI	YGGCCR	1 cut(s)	484
AcsI	RAATTY	1 cut(s)	1643
AcuI	CTGAAG	3 cut(s)	880, 1309, 1678
AgsI	TTSAA	8 cut(s)	102, 132, 478, 915, 1272, 1591, 1642, 1713
AjnI	CCWGG	1 cut(s)	1684
AleI	CACNNNNGTG	1 cut(s)	333
AluBI	AGCT	6 cut(s)	117, 582, 618, 723, 759, 1587
AluI	AGCT	6 cut(s)	117, 582, 618, 723, 759, 1587
Alw21I	GWGCWC	3 cut(s)	49, 562, 1497
Alw26I	GTCTC	3 cut(s)	48, 365, 1344
AlwI	GGATC	1 cut(s)	1646
AoxI	GGCC	3 cut(s)	484, 1082, 1301
ApeKI	GCWGC	5 cut(s)	503, 506, 582, 723, 1731
ApoI	RAATTY	1 cut(s)	1643
AspS9I	GGNCC	2 cut(s)	1301, 1406
AsuHPI	GGTGA	4 cut(s)	102, 119, 153, 1185
AvaII	GGWCC	1 cut(s)	1406
BalI	TGGCCA	1 cut(s)	486
Bbv12I	GWGCWC	3 cut(s)	49, 562, 1497
BbvI	GCAGC	5 cut(s)	515, 518, 569, 710, 1718
BccI	CCATC	2 cut(s)	129, 1290
BciT130I	CCWGG	1 cut(s)	1686
BcoDI	GTCTC	3 cut(s)	48, 365, 1344
BfmI	CTRYAG	5 cut(s)	331, 412, 868, 1027, 1732
BglII	AGATCT	2 cut(s)	570, 711
BisI	GCNGC	5 cut(s)	504, 507, 583, 724, 1732
BlpI	GCTNAGC	1 cut(s)	538
BlsI	GCNGC	5 cut(s)	505, 508, 584, 725, 1733
Bme1390I	CCNGG	1 cut(s)	1686
Bme18I	GGWCC	1 cut(s)	1406
BmgT120I	GGNCC	2 cut(s)	1301, 1406
BmiI	GGNNCC	1 cut(s)	1302
BmrFI	CCNGG	1 cut(s)	1686
BmrI	ACTGGG	1 cut(s)	1363
BmsI	GCATC	8 cut(s)	179, 900, 1037, 1059, 1067, 1142, 1221, 1718
BmuI	ACTGGG	1 cut(s)	1363
Bpu1102I	GCTNAGC	1 cut(s)	538
BpuEI	CTTGAG	1 cut(s)	1040
BsaI	GGTCTC	1 cut(s)	365
BsaJI	CCNNGG	1 cut(s)	1160
Bse1I	ACTGG	4 cut(s)	196, 472, 487, 1358
Bse3DI	GCAATG	3 cut(s)	1145, 1151, 1571
BseBI	CCWGG	1 cut(s)	1686
BseDI	CCNNGG	1 cut(s)	1160
BseGI	GGATG	2 cut(s)	1050, 1157
BseMI	GCAATG	3 cut(s)	1145, 1151, 1571
BseNI	ACTGG	4 cut(s)	196, 472, 487, 1358
BseRI	GAGGAG	3 cut(s)	21, 48, 171
BseXI	GCAGC	5 cut(s)	515, 518, 569, 710, 1718
BsgI	GTGCAG	2 cut(s)	1018, 1564
Bsh1236I	CGCG	2 cut(s)	1446, 1473
BshFI	GGCC	3 cut(s)	486, 1084, 1303
BsiHKAI	GWGCWC	3 cut(s)	49, 562, 1497
BsmAI	GTCTC	3 cut(s)	48, 365, 1344
BsnI	GGCC	3 cut(s)	486, 1084, 1303
Bso31I	GGTCTC	1 cut(s)	365
Bsp1286I	GDGCHC	3 cut(s)	49, 562, 1497
Bsp143I	GATC	4 cut(s)	122, 570, 711, 1651
Bsp1720I	GCTNAGC	1 cut(s)	538
Bsp19I	CCATGG	1 cut(s)	1160
BspACI	CCGC	5 cut(s)	296, 308, 1149, 1498, 1549
BspANI	GGCC	3 cut(s)	486, 1084, 1303
BspFNI	CGCG	2 cut(s)	1446, 1473
BspHI	TCATGA	1 cut(s)	209
BspLI	GGNNCC	1 cut(s)	1302
BspMAI	CTGCAG	1 cut(s)	1736
BspPI	GGATC	1 cut(s)	1646
BspQI	GCTCTTC	2 cut(s)	37, 163
BspTNI	GGTCTC	1 cut(s)	365
BsrDI	GCAATG	3 cut(s)	1145, 1151, 1571
BsrI	ACTGG	4 cut(s)	196, 472, 487, 1358
BssECI	CCNNGG	1 cut(s)	1160
BssMI	GATC	4 cut(s)	122, 570, 711, 1651
BssNAI	GTATAC	1 cut(s)	960
BssT1I	CCWWGG	1 cut(s)	1160
Bst1107I	GTATAC	1 cut(s)	960
Bst2UI	CCWGG	1 cut(s)	1686
Bst4CI	ACNGT	7 cut(s)	332, 416, 548, 591, 732, 935, 1101
Bst6I	CTCTTC	4 cut(s)	37, 163, 1184, 1657
BstC8I	GCNNGC	2 cut(s)	1082, 1547
BstDSI	CCRYGG	1 cut(s)	1160
BstF5I	GGATG	2 cut(s)	1050, 1157
BstFNI	CGCG	2 cut(s)	1446, 1473
BstKTI	GATC	4 cut(s)	125, 573, 714, 1654
BstMAI	GTCTC	3 cut(s)	48, 365, 1344
BstMBI	GATC	4 cut(s)	122, 570, 711, 1651
BstMWI	GCNNNNNNNGC	2 cut(s)	189, 198
BstNI	CCWGG	1 cut(s)	1686
BstSCI	CCNGG	1 cut(s)	1684
BstSFI	CTRYAG	5 cut(s)	331, 412, 868, 1027, 1732
BstUI	CGCG	2 cut(s)	1446, 1473
BstV1I	GCAGC	5 cut(s)	515, 518, 569, 710, 1718
BstX2I	RGATCY	2 cut(s)	570, 711
BstXI	CCANNNNNNTGG	1 cut(s)	203
BstYI	RGATCY	2 cut(s)	570, 711
BstZ17I	GTATAC	1 cut(s)	960
BsuRI	GGCC	3 cut(s)	486, 1084, 1303
BtgI	CCRYGG	1 cut(s)	1160
BtsCI	GGATG	2 cut(s)	1050, 1157
BtsI	GCAGTG	2 cut(s)	382, 392
Cac8I	GCNNGC	2 cut(s)	1082, 1547
CciI	TCATGA	1 cut(s)	209
Cfr13I	GGNCC	2 cut(s)	1301, 1406
CviAII	CATG	3 cut(s)	210, 902, 1161
DpnI	GATC	4 cut(s)	124, 572, 713, 1653
DpnII	GATC	4 cut(s)	122, 570, 711, 1651
EaeI	YGGCCR	1 cut(s)	484
Eam1104I	CTCTTC	4 cut(s)	37, 163, 1184, 1657
EarI	CTCTTC	4 cut(s)	37, 163, 1184, 1657
EciI	GGCGGA	1 cut(s)	1564
Eco130I	CCWWGG	1 cut(s)	1160
Eco31I	GGTCTC	1 cut(s)	365
Eco47I	GGWCC	1 cut(s)	1406
Eco57I	CTGAAG	3 cut(s)	880, 1309, 1678
EcoRII	CCWGG	1 cut(s)	1684
EcoT14I	CCWWGG	1 cut(s)	1160
EcoT22I	ATGCAT	1 cut(s)	1052
ErhI	CCWWGG	1 cut(s)	1160
FaeI	CATG	3 cut(s)	213, 905, 1164
FaiI	YATR	6 cut(s)	151, 211, 903, 960, 1162, 1680
FatI	CATG	3 cut(s)	209, 901, 1160
FauI	CCCGC	2 cut(s)	289, 301
FblI	GTMKAC	1 cut(s)	959
Fnu4HI	GCNGC	5 cut(s)	504, 507, 583, 724, 1732
FokI	GGATG	2 cut(s)	1037, 1164
Fsp4HI	GCNGC	5 cut(s)	504, 507, 583, 724, 1732
GluI	GCNGC	5 cut(s)	504, 507, 583, 724, 1732
HaeIII	GGCC	3 cut(s)	486, 1084, 1303
Hin1II	CATG	3 cut(s)	213, 905, 1164
HincII	GTYRAC	2 cut(s)	284, 854
HindII	GTYRAC	2 cut(s)	284, 854
HindIII	AAGCTT	1 cut(s)	1585
HphI	GGTGA	4 cut(s)	102, 119, 153, 1185
Hpy166II	GTNNAC	5 cut(s)	284, 515, 854, 960, 1718
Hpy188III	TCNNGA	4 cut(s)	132, 210, 607, 1409
Hpy8I	GTNNAC	5 cut(s)	284, 515, 854, 960, 1718
HpyAV	CCTTC	7 cut(s)	81, 454, 629, 770, 936, 1533, 1568
HpyCH4III	ACNGT	7 cut(s)	332, 416, 548, 591, 732, 935, 1101
HpyCH4IV	ACGT	1 cut(s)	985
HpyF10VI	GCNNNNNNNGC	2 cut(s)	189, 198
HpySE526I	ACGT	1 cut(s)	985
Hsp92II	CATG	3 cut(s)	213, 905, 1164
Kzo9I	GATC	4 cut(s)	122, 570, 711, 1651
LguI	GCTCTTC	2 cut(s)	37, 163
Lsp1109I	GCAGC	5 cut(s)	515, 518, 569, 710, 1718
LweI	GCATC	8 cut(s)	179, 900, 1037, 1059, 1067, 1142, 1221, 1718
MaeII	ACGT	1 cut(s)	985
MaeIII	GTNAC	7 cut(s)	416, 551, 692, 833, 927, 1173, 1461
MalI	GATC	4 cut(s)	124, 572, 713, 1653
MboI	GATC	4 cut(s)	122, 570, 711, 1651
MflI	RGATCY	2 cut(s)	570, 711
MhlI	GDGCHC	3 cut(s)	49, 562, 1497
MlsI	TGGCCA	1 cut(s)	486
MluCI	AATT	4 cut(s)	818, 1022, 1184, 1643
MluNI	TGGCCA	1 cut(s)	486
MlyI	GAGTC	6 cut(s)	20, 540, 597, 666, 738, 1170
Mox20I	TGGCCA	1 cut(s)	486
Mph1103I	ATGCAT	1 cut(s)	1052
MscI	TGGCCA	1 cut(s)	486
MseI	TTAA	1 cut(s)	1318
MslI	CAYNNNNRTG	2 cut(s)	333, 1723
Msp20I	TGGCCA	1 cut(s)	486
MspA1I	CMGCKG	1 cut(s)	308
MspR9I	CCNGG	1 cut(s)	1686
MvaI	CCWGG	1 cut(s)	1686
MvnI	CGCG	2 cut(s)	1446, 1473
MwoI	GCNNNNNNNGC	2 cut(s)	189, 198
NcoI	CCATGG	1 cut(s)	1160
NdeII	GATC	4 cut(s)	122, 570, 711, 1651
NlaIII	CATG	3 cut(s)	213, 905, 1164
NlaIV	GGNNCC	1 cut(s)	1302
NmuCI	GTSAC	6 cut(s)	551, 692, 833, 927, 1173, 1461
NsiI	ATGCAT	1 cut(s)	1052
OliI	CACNNNNGTG	1 cut(s)	333
PagI	TCATGA	1 cut(s)	209
PciSI	GCTCTTC	2 cut(s)	37, 163
PkrI	GCNGC	5 cut(s)	505, 508, 584, 725, 1733
PleI	GAGTC	6 cut(s)	19, 539, 597, 666, 738, 1170
PpsI	GAGTC	6 cut(s)	19, 539, 597, 666, 738, 1170
Psp6I	CCWGG	1 cut(s)	1684
PspGI	CCWGG	1 cut(s)	1684
PspN4I	GGNNCC	1 cut(s)	1302
PspPI	GGNCC	2 cut(s)	1301, 1406
PstI	CTGCAG	1 cut(s)	1736
PsuI	RGATCY	2 cut(s)	570, 711
RseI	CAYNNNNRTG	2 cut(s)	333, 1723
SapI	GCTCTTC	2 cut(s)	37, 163
SaqAI	TTAA	1 cut(s)	1318
SatI	GCNGC	5 cut(s)	504, 507, 583, 724, 1732
Sau3AI	GATC	4 cut(s)	122, 570, 711, 1651
Sau96I	GGNCC	2 cut(s)	1301, 1406
SchI	GAGTC	6 cut(s)	20, 540, 597, 666, 738, 1170
ScrFI	CCNGG	1 cut(s)	1686
SduI	GDGCHC	3 cut(s)	49, 562, 1497
SfaNI	GCATC	8 cut(s)	179, 900, 1037, 1059, 1067, 1142, 1221, 1718
SfcI	CTRYAG	5 cut(s)	331, 412, 868, 1027, 1732
SinI	GGWCC	1 cut(s)	1406
SmiMI	CAYNNNNRTG	2 cut(s)	333, 1723
SmlI	CTYRAG	1 cut(s)	1055
SmoI	CTYRAG	1 cut(s)	1055
Sse9I	AATT	4 cut(s)	818, 1022, 1184, 1643
SsiI	CCGC	5 cut(s)	296, 308, 1149, 1498, 1549
StyD4I	CCNGG	1 cut(s)	1684
StyI	CCWWGG	1 cut(s)	1160
TaaI	ACNGT	7 cut(s)	332, 416, 548, 591, 732, 935, 1101
TaiI	ACGT	1 cut(s)	988
TaqI	TCGA	1 cut(s)	1650
TaqII	GACCGA	3 cut(s)	347, 1449, 1476
TasI	AATT	4 cut(s)	818, 1022, 1184, 1643
Tru1I	TTAA	1 cut(s)	1318
Tru9I	TTAA	1 cut(s)	1318
TseFI	GTSAC	6 cut(s)	551, 692, 833, 927, 1173, 1461
TseI	GCWGC	5 cut(s)	503, 506, 582, 723, 1731
Tsp45I	GTSAC	6 cut(s)	551, 692, 833, 927, 1173, 1461
TspDTI	ATGAA	6 cut(s)	226, 253, 918, 1105, 1552, 1597
VpaK11BI	GGWCC	1 cut(s)	1406
XapI	RAATTY	1 cut(s)	1643
XcmI	CCANNNNNNNNNTGG	1 cut(s)	479
XmiI	GTMKAC	1 cut(s)	959
Zsp2I	ATGCAT	1 cut(s)	1052

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.