Rmu_sc0000616.1_g000014

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000616.1
Physical Location & Seq
Forward (+)
80502 .. 81335
834 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000616.1_g000014.1.cds

Sequence Viewer

Length: 834 bp
atgttgaagcaatcacccagtagaaaccagagggtaaaaggcttcaaggtaaagcatgctgttcagatatctttgttgcttgctatttgcatctggctggtttatcaactcaatcactcccatggtgaaaaagcacttgaagtcagctctgcagagaagaaatcaggcgaggtgcaaaatgagcatggagtactagaacttgggagacggggcctccgtcctcgtgtggaagaaacttcgatggatgttggaaggcatagggaaaaagaggaagaatcagaagaagaggcagatgagactaaagctgaagaaagtgaggaggaaggaagaggcggtgaagatgaagttgaagggcatgatcaagagaaatccgaggaagaatctgagggggtagaggatttgattgatgaagatgatacggagagagaagaagaaagtgaagaacaagagagtgaagagcaaggaaatgatttggaggatcaagttcaaaatagagatacaaggtatagccaagatgcaagagaggagcaatacaatggtgatgatgcatccagtgctgtgaagcagaacatccgcactataagcaaccaaatcgaaattggaagcttgagaagagtgaaggaagaagaggtaaacactgcagaaaatattgatttagagaaagataataaagccagtactggtgaaacaaaaggtaatcagtttggttcagtcaagagagatggtcaaacagatgctggttcatcaaccactacaagtgaaaaaccaaaaaggagcaatggttctctttatggaacagagatgctactcaagttatattatgattcaatctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

277

Amino Acids

31.3

Weight (kDa)

4.54

Isoelectric Point (pI)

63.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 333, 574
AclWI GGATC 1 cut(s) 486
AcuI CTGAAG 1 cut(s) 327
AfaI GTAC 2 cut(s) 192, 679
AgsI TTSAA 6 cut(s) 7, 46, 140, 350, 488, 828
AloI GAACNNNNNNTCC 2 cut(s) 766, 798
AluBI AGCT 3 cut(s) 147, 305, 606
AluI AGCT 3 cut(s) 147, 305, 606
Alw26I GTCTC 2 cut(s) 199, 290
AlwI GGATC 1 cut(s) 486
AlwNI CAGNNNCTG 1 cut(s) 737
AoxI GGCC 1 cut(s) 211
AspS9I GGNCC 1 cut(s) 211
AsuHPI GGTGA 5 cut(s) 6, 137, 347, 551, 695
BauI CACGAG 1 cut(s) 222
BccI CCATC 2 cut(s) 235, 716
BcgI CGANNNNNNTGC 2 cut(s) 574, 608
BclI TGATCA 1 cut(s) 358
BcoDI GTCTC 2 cut(s) 199, 290
BfaI CTAG 1 cut(s) 194
BfmI CTRYAG 2 cut(s) 150, 639
BmcAI AGTACT 2 cut(s) 192, 679
BmgT120I GGNCC 1 cut(s) 211
BmiI GGNNCC 1 cut(s) 212
BmrI ACTGGG 1 cut(s) 12
BmsI GCATC 6 cut(s) 99, 505, 535, 557, 724, 792
BmuI ACTGGG 1 cut(s) 12
BpuEI CTTGAG 2 cut(s) 628, 794
BsaJI CCNNGG 2 cut(s) 121, 372
BsaXI ACNNNNNCTCC 4 cut(s) 198, 228, 766, 796
Bse1I ACTGG 4 cut(s) 18, 552, 675, 685
Bse3DI GCAATG 1 cut(s) 784
BseDI CCNNGG 2 cut(s) 121, 372
BseGI GGATG 3 cut(s) 250, 548, 570
BseMI GCAATG 1 cut(s) 784
BseMII CTCAG 1 cut(s) 375
BseNI ACTGG 4 cut(s) 18, 552, 675, 685
BseRI GAGGAG 2 cut(s) 332, 539
BshFI GGCC 1 cut(s) 213
BsmAI GTCTC 2 cut(s) 199, 290
BsmBI CGTCTC 1 cut(s) 199
BsnI GGCC 1 cut(s) 213
Bsp143I GATC 2 cut(s) 358, 478
Bsp19I CCATGG 1 cut(s) 121
BspACI CCGC 2 cut(s) 333, 574
BspANI GGCC 1 cut(s) 213
BspCNI CTCAG 1 cut(s) 376
BspLI GGNNCC 1 cut(s) 212
BspMAI CTGCAG 2 cut(s) 154, 643
BspPI GGATC 1 cut(s) 486
BspQI GCTCTTC 1 cut(s) 450
BsrDI GCAATG 1 cut(s) 784
BsrI ACTGG 4 cut(s) 18, 552, 675, 685
BssECI CCNNGG 2 cut(s) 121, 372
BssMI GATC 2 cut(s) 358, 478
BssSI CACGAG 1 cut(s) 222
BssT1I CCWWGG 1 cut(s) 121
Bst2BI CACGAG 1 cut(s) 222
Bst6I CTCTTC 5 cut(s) 279, 322, 450, 607, 621
BstAPI GCANNNNNTGC 1 cut(s) 554
BstC8I GCNNGC 2 cut(s) 57, 81
BstDEI CTNAG 1 cut(s) 384
BstDSI CCRYGG 1 cut(s) 121
BstF5I GGATG 3 cut(s) 250, 548, 570
BstKTI GATC 2 cut(s) 361, 481
BstMAI GTCTC 2 cut(s) 199, 290
BstMBI GATC 2 cut(s) 358, 478
BstMWI GCNNNNNNNGC 3 cut(s) 181, 554, 582
BstNSI RCATGY 1 cut(s) 59
BstSFI CTRYAG 2 cut(s) 150, 639
BsuRI GGCC 1 cut(s) 213
BtgI CCRYGG 1 cut(s) 121
BtsCI GGATG 3 cut(s) 250, 548, 570
BtsI GCAGTG 1 cut(s) 636
BtsIMutI CAGTG 2 cut(s) 559, 636
Cac8I GCNNGC 2 cut(s) 57, 81
CaiI CAGNNNCTG 1 cut(s) 737
Cfr13I GGNCC 1 cut(s) 211
Csp6I GTAC 2 cut(s) 191, 678
CviAII CATG 4 cut(s) 56, 122, 185, 356
CviJI RGCY 8 cut(s) 42, 97, 147, 213, 305, 510, 606, 674
CviKI_1 RGCY 8 cut(s) 42, 97, 147, 213, 305, 510, 606, 674
CviQI GTAC 2 cut(s) 191, 678
DdeI CTNAG 1 cut(s) 384
DpnI GATC 2 cut(s) 360, 480
DpnII GATC 2 cut(s) 358, 478
Eam1104I CTCTTC 5 cut(s) 279, 322, 450, 607, 621
EarI CTCTTC 5 cut(s) 279, 322, 450, 607, 621
Eco130I CCWWGG 1 cut(s) 121
Eco32I GATATC 1 cut(s) 69
Eco57I CTGAAG 1 cut(s) 327
EcoO109I RGGNCCY 1 cut(s) 211
EcoRV GATATC 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 121
EcoT22I ATGCAT 1 cut(s) 550
ErhI CCWWGG 1 cut(s) 121
Esp3I CGTCTC 1 cut(s) 199
FaeI CATG 4 cut(s) 59, 125, 188, 359
FatI CATG 4 cut(s) 55, 121, 184, 355
FbaI TGATCA 1 cut(s) 358
FokI GGATG 3 cut(s) 257, 535, 557
FspBI CTAG 1 cut(s) 194
HaeIII GGCC 1 cut(s) 213
Hin1II CATG 4 cut(s) 59, 125, 188, 359
HindIII AAGCTT 1 cut(s) 604
HinfI GANTC 3 cut(s) 275, 380, 824
HphI GGTGA 5 cut(s) 6, 137, 347, 551, 695
Hpy166II GTNNAC 1 cut(s) 634
Hpy188I TCNGA 4 cut(s) 66, 280, 373, 385
Hpy188III TCNNGA 2 cut(s) 362, 715
Hpy8I GTNNAC 1 cut(s) 634
HpyAV CCTTC 4 cut(s) 246, 317, 344, 613
HpyCH4V TGCA 6 cut(s) 90, 152, 175, 518, 548, 641
HpyF10VI GCNNNNNNNGC 3 cut(s) 181, 554, 582
HpyF3I CTNAG 1 cut(s) 384
Hsp92II CATG 4 cut(s) 59, 125, 188, 359
Ksp22I TGATCA 1 cut(s) 358
Kzo9I GATC 2 cut(s) 358, 478
LguI GCTCTTC 1 cut(s) 450
LmnI GCTCC 2 cut(s) 526, 774
LpnPI CCDG 9 cut(s) 31, 41, 79, 83, 150, 565, 666, 688, 723
LweI GCATC 6 cut(s) 99, 505, 535, 557, 724, 792
MaeI CTAG 1 cut(s) 194
MalI GATC 2 cut(s) 360, 480
MboI GATC 2 cut(s) 358, 478
MluCI AATT 1 cut(s) 597
MmeI TCCRAC 1 cut(s) 229
Mph1103I ATGCAT 1 cut(s) 550
MslI CAYNNNNRTG 1 cut(s) 120
MwoI GCNNNNNNNGC 3 cut(s) 181, 554, 582
NcoI CCATGG 1 cut(s) 121
NdeII GATC 2 cut(s) 358, 478
NlaIII CATG 4 cut(s) 59, 125, 188, 359
NlaIV GGNNCC 1 cut(s) 212
NsiI ATGCAT 1 cut(s) 550
NspI RCATGY 1 cut(s) 59
PaeI GCATGC 1 cut(s) 59
PciSI GCTCTTC 1 cut(s) 450
PcsI WCGNNNNNNNCGW 1 cut(s) 214
PfeI GAWTC 3 cut(s) 275, 380, 824
PspN4I GGNNCC 1 cut(s) 212
PspPI GGNCC 1 cut(s) 211
PstI CTGCAG 2 cut(s) 154, 643
PstNI CAGNNNCTG 1 cut(s) 737
RsaI GTAC 2 cut(s) 192, 679
RsaNI GTAC 2 cut(s) 191, 678
RseI CAYNNNNRTG 1 cut(s) 120
SapI GCTCTTC 1 cut(s) 450
Sau3AI GATC 2 cut(s) 358, 478
Sau96I GGNCC 1 cut(s) 211
ScaI AGTACT 2 cut(s) 192, 679
SetI ASST 8 cut(s) 51, 149, 174, 307, 506, 608, 633, 697
SfaNI GCATC 6 cut(s) 99, 505, 535, 557, 724, 792
SfcI CTRYAG 2 cut(s) 150, 639
SmiMI CAYNNNNRTG 1 cut(s) 120
SmlI CTYRAG 2 cut(s) 607, 809
SmoI CTYRAG 2 cut(s) 607, 809
SphI GCATGC 1 cut(s) 59
Sse9I AATT 1 cut(s) 597
SsiI CCGC 2 cut(s) 333, 574
SspI AATATT 1 cut(s) 649
SspMI CTAG 1 cut(s) 194
StyI CCWWGG 1 cut(s) 121
TaqI TCGA 2 cut(s) 239, 594
TasI AATT 1 cut(s) 597
TatI WGTACW 2 cut(s) 190, 677
TfiI GAWTC 3 cut(s) 275, 380, 824
TscAI CASTG 2 cut(s) 559, 643
TspDTI ATGAA 3 cut(s) 357, 423, 732
TspGWI ACGGA 2 cut(s) 206, 434
TspRI CASTG 2 cut(s) 559, 643
XceI RCATGY 1 cut(s) 59
XcmI CCANNNNNNNNNTGG 1 cut(s) 596
XspI CTAG 1 cut(s) 194
ZrmI AGTACT 2 cut(s) 192, 679
Zsp2I ATGCAT 1 cut(s) 550
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.