Rmu_sc0000433.1_g000001

Transcription factor ILR3-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000433.1
Physical Location & Seq
Forward (+)
1084 .. 3031
1948 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000433.1_g000001.1.cds

Sequence Viewer

Length: 747 bp
atggctgctcctgcttcttcttcgccgccgccgcagaattgggtcttcgattatgatctgattgagagcatctctgttcccggtggtgacttgccttctcttgacccgcccggtttctcttggggctccgattcgtttcccgctccgaccgccccaagcgtggactttgatggctcctttggaaattccgagattatgaaggaaactgggtcgaacaaacgtgcgaggtccggatcgtgcaatgtgtctggttctaaagcctgtagagagaaaatgcggagggacagactgaatgacaagttcctggaattgagtactatccttgaacctggaaggccacctaaaactgacaaagctgctatattggttgatgctgttcgaatggtgaatcagttacgtggggaagcccaaaatctgaaggagtcgagtgagagtctgcaggagaagataactgaattgaaggctgagaagaacgaacttcgtgatgagaagcagaggctaaaagcagagaaagagaaccttgagcggcaaattaaagccttaggtacacaaccgggcttcttgcctcaccctgctgcgattccagctccattttctgcccccggccaagttgttggcggtaaactgatgccgttcatgggatatcctggagtttctggataccctggagtttctatgtggcagttcatgccacaggctgcagttgatacatcacaagatcatgttcgccgtcccccagttgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

248

Amino Acids

26.92

Weight (kDa)

6.2

Isoelectric Point (pI)

62.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 143, 526
AccIII TCCGGA 1 cut(s) 230
AciI CCGC 9 cut(s) 26, 29, 32, 107, 141, 150, 277, 526, 618
AclWI GGATC 1 cut(s) 241
AcoI YGGCCR 1 cut(s) 604
AcsI RAATTY 1 cut(s) 184
AcuI CTGAAG 1 cut(s) 437
AfaI GTAC 2 cut(s) 316, 547
AfiI CCNNNNNNNGG 2 cut(s) 160, 638
AgsI TTSAA 2 cut(s) 326, 460
AjnI CCWGG 4 cut(s) 303, 328, 646, 664
AluBI AGCT 2 cut(s) 356, 587
AluI AGCT 2 cut(s) 356, 587
AlwI GGATC 1 cut(s) 241
Aor13HI TCCGGA 1 cut(s) 230
AoxI GGCC 2 cut(s) 335, 604
ApeKI GCWGC 4 cut(s) 5, 356, 575, 698
ApoI RAATTY 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 228
AsuC2I CCSGG 4 cut(s) 81, 111, 555, 603
AsuHPI GGTGA 3 cut(s) 98, 397, 560
AsuII TTCGAA 1 cut(s) 379
AvaII GGWCC 1 cut(s) 228
AxyI CCTNAGG 1 cut(s) 541
BanII GRGCYC 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 37
BbvI GCAGC 3 cut(s) 343, 562, 685
BccI CCATC 1 cut(s) 164
BceAI ACGGC 2 cut(s) 616, 714
BciT130I CCWGG 4 cut(s) 305, 330, 648, 666
BciVI GTATCC 1 cut(s) 653
BcnI CCSGG 4 cut(s) 81, 111, 555, 603
BfmI CTRYAG 3 cut(s) 262, 437, 699
BfuI GTATCC 1 cut(s) 653
BisI GCNGC 8 cut(s) 6, 26, 29, 32, 357, 527, 576, 699
BlsI GCNGC 8 cut(s) 7, 27, 30, 33, 358, 528, 577, 700
BmcAI AGTACT 1 cut(s) 316
Bme1390I CCNGG 8 cut(s) 81, 111, 305, 330, 555, 603, 648, 666
Bme18I GGWCC 1 cut(s) 228
BmgT120I GGNCC 1 cut(s) 228
BmiI GGNNCC 2 cut(s) 127, 175
BmrFI CCNGG 8 cut(s) 81, 111, 305, 330, 555, 603, 648, 666
BmrI ACTGGG 2 cut(s) 216, 731
BmsI GCATC 3 cut(s) 78, 361, 618
BmuI ACTGGG 2 cut(s) 216, 731
BpiI GAAGAC 1 cut(s) 37
BplI GAGNNNNNCTC 2 cut(s) 56, 88
BpmI CTGGAG 2 cut(s) 669, 687
Bpu14I TTCGAA 1 cut(s) 379
BpuEI CTTGAG 1 cut(s) 542
BpuMI CCSGG 4 cut(s) 81, 111, 555, 603
BsaAI YACGTR 1 cut(s) 398
BsaBI GATNNNNATC 1 cut(s) 54
BsaJI CCNNGG 2 cut(s) 601, 664
BsaWI WCCGGW 1 cut(s) 230
Bsc4I CCNNNNNNNGG 2 cut(s) 160, 638
Bse1I ACTGG 2 cut(s) 211, 737
Bse21I CCTNAGG 1 cut(s) 541
Bse3DI GCAATG 1 cut(s) 247
Bse8I GATNNNNATC 1 cut(s) 54
BseAI TCCGGA 1 cut(s) 230
BseBI CCWGG 4 cut(s) 305, 330, 648, 666
BseDI CCNNGG 2 cut(s) 601, 664
BseJI GATNNNNATC 1 cut(s) 54
BseLI CCNNNNNNNGG 2 cut(s) 160, 638
BseMI GCAATG 1 cut(s) 247
BseMII CTCAG 1 cut(s) 456
BseNI ACTGG 2 cut(s) 211, 737
BseXI GCAGC 3 cut(s) 343, 562, 685
Bsh1285I CGRYCG 1 cut(s) 150
BshFI GGCC 2 cut(s) 337, 606
BsiEI CGRYCG 1 cut(s) 150
BsiSI CCGG 5 cut(s) 81, 111, 231, 554, 603
BslFI GGGAC 2 cut(s) 296, 717
BslI CCNNNNNNNGG 2 cut(s) 160, 638
BsmFI GGGAC 2 cut(s) 296, 717
BsnI GGCC 2 cut(s) 337, 606
Bsp119I TTCGAA 1 cut(s) 379
Bsp1286I GDGCHC 1 cut(s) 128
Bsp13I TCCGGA 1 cut(s) 230
Bsp143I GATC 3 cut(s) 55, 233, 718
BspACI CCGC 9 cut(s) 26, 29, 32, 107, 141, 150, 277, 526, 618
BspANI GGCC 2 cut(s) 337, 606
BspCNI CTCAG 1 cut(s) 457
BspEI TCCGGA 1 cut(s) 230
BspLI GGNNCC 2 cut(s) 127, 175
BspMAI CTGCAG 2 cut(s) 441, 703
BspPI GGATC 1 cut(s) 241
BspT104I TTCGAA 1 cut(s) 379
BsrBI CCGCTC 2 cut(s) 143, 526
BsrDI GCAATG 1 cut(s) 247
BsrI ACTGG 2 cut(s) 211, 737
BssECI CCNNGG 2 cut(s) 601, 664
BssMI GATC 3 cut(s) 55, 233, 718
Bst2UI CCWGG 4 cut(s) 305, 330, 648, 666
BstAPI GCANNNNNTGC 1 cut(s) 688
BstBAI YACGTR 1 cut(s) 398
BstBI TTCGAA 1 cut(s) 379
BstDEI CTNAG 2 cut(s) 465, 541
BstKTI GATC 3 cut(s) 58, 236, 721
BstMBI GATC 3 cut(s) 55, 233, 718
BstMCI CGRYCG 1 cut(s) 150
BstMWI GCNNNNNNNGC 5 cut(s) 11, 31, 149, 584, 688
BstNI CCWGG 4 cut(s) 305, 330, 648, 666
BstSCI CCNGG 8 cut(s) 79, 109, 303, 328, 553, 601, 646, 664
BstSFI CTRYAG 3 cut(s) 262, 437, 699
BstV1I GCAGC 3 cut(s) 343, 562, 685
BstV2I GAAGAC 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 614
Bsu36I CCTNAGG 1 cut(s) 541
BsuI GTATCC 1 cut(s) 653
BsuRI GGCC 2 cut(s) 337, 606
Cfr13I GGNCC 1 cut(s) 228
Csp6I GTAC 2 cut(s) 315, 546
CviAII CATG 3 cut(s) 637, 688, 722
CviQI GTAC 2 cut(s) 315, 546
DdeI CTNAG 2 cut(s) 465, 541
DpnI GATC 3 cut(s) 57, 235, 720
DpnII GATC 3 cut(s) 55, 233, 718
EaeI YGGCCR 1 cut(s) 604
Eco24I GRGCYC 1 cut(s) 128
Eco32I GATATC 1 cut(s) 644
Eco47I GGWCC 1 cut(s) 228
Eco57I CTGAAG 1 cut(s) 437
Eco81I CCTNAGG 1 cut(s) 541
EcoRII CCWGG 4 cut(s) 303, 328, 646, 664
EcoRV GATATC 1 cut(s) 644
EcoT38I GRGCYC 1 cut(s) 128
FaeI CATG 3 cut(s) 640, 691, 725
FaiI YATR 7 cut(s) 54, 197, 362, 638, 677, 689, 723
FalI AAGNNNNNCTT 2 cut(s) 504, 536
FaqI GGGAC 2 cut(s) 296, 717
FatI CATG 3 cut(s) 636, 687, 721
FauI CCCGC 2 cut(s) 114, 148
Fnu4HI GCNGC 8 cut(s) 6, 26, 29, 32, 357, 527, 576, 699
FriOI GRGCYC 1 cut(s) 128
Fsp4HI GCNGC 8 cut(s) 6, 26, 29, 32, 357, 527, 576, 699
GluI GCNGC 8 cut(s) 6, 26, 29, 32, 357, 527, 576, 699
GsuI CTGGAG 2 cut(s) 669, 687
HaeIII GGCC 2 cut(s) 337, 606
HapII CCGG 5 cut(s) 81, 111, 231, 554, 603
Hin1II CATG 3 cut(s) 640, 691, 725
HinfI GANTC 5 cut(s) 131, 388, 422, 433, 580
HpaII CCGG 5 cut(s) 81, 111, 231, 554, 603
HphI GGTGA 3 cut(s) 98, 397, 560
Hpy166II GTNNAC 3 cut(s) 163, 548, 623
Hpy188I TCNGA 5 cut(s) 60, 130, 147, 190, 417
Hpy188III TCNNGA 4 cut(s) 101, 231, 482, 657
Hpy8I GTNNAC 3 cut(s) 163, 548, 623
HpyAV CCTTC 5 cut(s) 105, 193, 327, 412, 454
HpyCH4IV ACGT 2 cut(s) 220, 397
HpyCH4V TGCA 3 cut(s) 240, 439, 701
HpyF10VI GCNNNNNNNGC 5 cut(s) 11, 31, 149, 584, 688
HpyF3I CTNAG 2 cut(s) 465, 541
HpySE526I ACGT 2 cut(s) 220, 397
Hsp92II CATG 3 cut(s) 640, 691, 725
Kpn2I TCCGGA 1 cut(s) 230
Kzo9I GATC 3 cut(s) 55, 233, 718
LmnI GCTCC 5 cut(s) 13, 131, 148, 179, 592
Lsp1109I GCAGC 3 cut(s) 343, 562, 685
LweI GCATC 3 cut(s) 78, 361, 618
MaeII ACGT 2 cut(s) 220, 397
MaeIII GTNAC 2 cut(s) 86, 393
MalI GATC 3 cut(s) 57, 235, 720
MbiI CCGCTC 2 cut(s) 143, 526
MboI GATC 3 cut(s) 55, 233, 718
MboII GAAGA 5 cut(s) 9, 12, 37, 457, 481
MhlI GDGCHC 1 cut(s) 128
MluCI AATT 5 cut(s) 37, 184, 308, 455, 531
MlyI GAGTC 2 cut(s) 431, 442
MmeI TCCRAC 1 cut(s) 170
MnlI CCTC 4 cut(s) 219, 273, 489, 576
MroI TCCGGA 1 cut(s) 230
MseI TTAA 1 cut(s) 534
MspI CCGG 5 cut(s) 81, 111, 231, 554, 603
MspR9I CCNGG 8 cut(s) 81, 111, 305, 330, 555, 603, 648, 666
MvaI CCWGG 4 cut(s) 305, 330, 648, 666
MwoI GCNNNNNNNGC 5 cut(s) 11, 31, 149, 584, 688
NciI CCSGG 4 cut(s) 81, 111, 555, 603
NdeII GATC 3 cut(s) 55, 233, 718
NlaIII CATG 3 cut(s) 640, 691, 725
NlaIV GGNNCC 2 cut(s) 127, 175
NmuCI GTSAC 1 cut(s) 86
NspV TTCGAA 1 cut(s) 379
PfeI GAWTC 3 cut(s) 131, 388, 580
PfoI TCCNGGA 2 cut(s) 303, 646
PkrI GCNGC 8 cut(s) 7, 27, 30, 33, 358, 528, 577, 700
PleI GAGTC 2 cut(s) 430, 441
PpsI GAGTC 2 cut(s) 430, 441
Ppu21I YACGTR 1 cut(s) 398
Psp6I CCWGG 4 cut(s) 303, 328, 646, 664
PspGI CCWGG 4 cut(s) 303, 328, 646, 664
PspN4I GGNNCC 2 cut(s) 127, 175
PspPI GGNCC 1 cut(s) 228
PstI CTGCAG 2 cut(s) 441, 703
RsaI GTAC 2 cut(s) 316, 547
RsaNI GTAC 2 cut(s) 315, 546
SaqAI TTAA 1 cut(s) 534
SatI GCNGC 8 cut(s) 6, 26, 29, 32, 357, 527, 576, 699
Sau3AI GATC 3 cut(s) 55, 233, 718
Sau96I GGNCC 1 cut(s) 228
ScaI AGTACT 1 cut(s) 316
SchI GAGTC 2 cut(s) 431, 442
ScrFI CCNGG 8 cut(s) 81, 111, 305, 330, 555, 603, 648, 666
SduI GDGCHC 1 cut(s) 128
SetI ASST 9 cut(s) 223, 230, 331, 343, 358, 400, 522, 547, 589
SfaNI GCATC 3 cut(s) 78, 361, 618
SfcI CTRYAG 3 cut(s) 262, 437, 699
SfuI TTCGAA 1 cut(s) 379
SinI GGWCC 1 cut(s) 228
SmlI CTYRAG 1 cut(s) 521
SmoI CTYRAG 1 cut(s) 521
Sse9I AATT 5 cut(s) 37, 184, 308, 455, 531
SsiI CCGC 9 cut(s) 26, 29, 32, 107, 141, 150, 277, 526, 618
StyD4I CCNGG 8 cut(s) 79, 109, 303, 328, 553, 601, 646, 664
TaiI ACGT 2 cut(s) 223, 400
TaqI TCGA 4 cut(s) 48, 212, 379, 425
TasI AATT 5 cut(s) 37, 184, 308, 455, 531
TatI WGTACW 1 cut(s) 314
TauI GCSGC 4 cut(s) 28, 31, 34, 529
TfiI GAWTC 3 cut(s) 131, 388, 580
Tru1I TTAA 1 cut(s) 534
Tru9I TTAA 1 cut(s) 534
TseFI GTSAC 1 cut(s) 86
TseI GCWGC 4 cut(s) 5, 356, 575, 698
Tsp45I GTSAC 1 cut(s) 86
TspDTI ATGAA 3 cut(s) 212, 625, 676
VpaK11BI GGWCC 1 cut(s) 228
XapI RAATTY 1 cut(s) 184
ZrmI AGTACT 1 cut(s) 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.