Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002453.1

Orthogroup ID

OG0003582

Physical Location & Seq

Genomic Coordinates Forward (+)

1456 .. 3407

Gene Structure 1952 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002453.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 747 bp

atggctgctcctgcttcttcttcgccaccgccgcagaattgggtcttcgattatgatctgattgagagcatctctgttcccggtggtgacttgccttctcttgacccgcccggtttctcttggggctccgattcgtttcccgctccgaccgccccaagcgtggactttgatggctcctttggaaattccgagattatgaaggaaactgggtcgaacaaacgtgcgaggtccggatcgtgcaatgtgtctggttctaaagcctgtagagagaaaatgcggagggacagactgaatgacaagttcctggaattgagtactatccttgaacctggaaggccacctaaaactgacaaagctgctatattggttgatgctgttcgaatggtgaatcagttacgtggggaagcccaaaatctgaaggagtcgagtgagagtctgcaggagaagataactgaattgaaggctgagaagaacgaacttcgtgatgagaagcagaggctaaaagcagagaaagagaaccttgagcggcaaattaaagccgtaggtacacaaccgggcttcttgcctcaccctgctgcgattccagctccattttctgcccctggccaagttgttggcggtaaactgatgccattcatgggatatcctggagtttctggataccctggagtttctatgtggcagttcatgccacaggctgcagttgatacatcacaaggtcatgttctccgtcccccagttgcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HLH

Protein Analysis

248

Amino Acids

26.81

Weight (kDa)

6.2

Isoelectric Point (pI)

59.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003582)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G54680
fragaria_vesca	FvH4_3g02910 FvH4_3g02910 FvH4_3g21720
malus_domestica	MD03G1212600.v1.1 MD05G1336500.v1.1 MD05G1336600.v1.1 MD10G1312000.v1.1 MD10G1312100.v1.1 MD11G1227800.v1.1
prunus_persica	Prupe.4G029000_v2.0.a1 Prupe.4G201500_v2.0.a1
pyrus_communis	pycom03g16130 pycom05g30800 pycom10g26330 pycom11g20040
rosa_chinensis	RchiOBHm_Chr5g0004471 RchiOBHm_Chr5g0037201
rosa_laevigata	RLG00000031231 RLG00000033764
rosa_multiflora	Rmu_sc0000433.1_g000001 Rmu_sc0002453.1_g000001
rosa_roxburghii	Rroxscaffold_1G00043770 Rroxscaffold_1G00071050
rosa_rugosa	Rorug04G0412000 Rorug05G0163600
rosa_samantha	Rh5AG039600 Rh5AG253200 Rh5BG038600 Rh5BG255200 Rh5CG042700 Rh5CG287900 Rh5DG038400
rosa_wichuraiana	Rw5G003780 Rw5G023390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	2 cut(s)	143, 526
AccIII	TCCGGA	1 cut(s)	230
AciI	CCGC	8 cut(s)	29, 32, 107, 141, 150, 277, 526, 618
AclWI	GGATC	1 cut(s)	241
AcoI	YGGCCR	1 cut(s)	604
AcsI	RAATTY	1 cut(s)	184
AcuI	CTGAAG	1 cut(s)	437
AfaI	GTAC	2 cut(s)	316, 547
AfiI	CCNNNNNNNGG	2 cut(s)	160, 638
AgsI	TTSAA	2 cut(s)	326, 460
AjnI	CCWGG	5 cut(s)	303, 328, 601, 646, 664
AluBI	AGCT	2 cut(s)	356, 587
AluI	AGCT	2 cut(s)	356, 587
AlwI	GGATC	1 cut(s)	241
Aor13HI	TCCGGA	1 cut(s)	230
AoxI	GGCC	2 cut(s)	335, 604
ApeKI	GCWGC	4 cut(s)	5, 356, 575, 698
ApoI	RAATTY	1 cut(s)	184
AspS9I	GGNCC	1 cut(s)	228
AsuC2I	CCSGG	3 cut(s)	81, 111, 555
AsuHPI	GGTGA	3 cut(s)	98, 397, 560
AsuII	TTCGAA	1 cut(s)	379
AvaII	GGWCC	1 cut(s)	228
BalI	TGGCCA	1 cut(s)	606
BanII	GRGCYC	1 cut(s)	128
BbsI	GAAGAC	1 cut(s)	37
BbvI	GCAGC	3 cut(s)	343, 562, 685
BccI	CCATC	1 cut(s)	164
BceAI	ACGGC	1 cut(s)	524
BciT130I	CCWGG	5 cut(s)	305, 330, 603, 648, 666
BciVI	GTATCC	1 cut(s)	653
BcnI	CCSGG	3 cut(s)	81, 111, 555
BfmI	CTRYAG	3 cut(s)	262, 437, 699
BfuI	GTATCC	1 cut(s)	653
BisI	GCNGC	6 cut(s)	6, 32, 357, 527, 576, 699
BlsI	GCNGC	6 cut(s)	7, 33, 358, 528, 577, 700
BmcAI	AGTACT	1 cut(s)	316
Bme1390I	CCNGG	8 cut(s)	81, 111, 305, 330, 555, 603, 648, 666
Bme18I	GGWCC	1 cut(s)	228
BmgT120I	GGNCC	1 cut(s)	228
BmiI	GGNNCC	2 cut(s)	127, 175
BmrFI	CCNGG	8 cut(s)	81, 111, 305, 330, 555, 603, 648, 666
BmrI	ACTGGG	2 cut(s)	216, 731
BmsI	GCATC	3 cut(s)	78, 361, 618
BmuI	ACTGGG	2 cut(s)	216, 731
BpiI	GAAGAC	1 cut(s)	37
BplI	GAGNNNNNCTC	2 cut(s)	56, 88
BpmI	CTGGAG	2 cut(s)	669, 687
Bpu14I	TTCGAA	1 cut(s)	379
BpuEI	CTTGAG	1 cut(s)	542
BpuMI	CCSGG	3 cut(s)	81, 111, 555
BsaAI	YACGTR	1 cut(s)	398
BsaBI	GATNNNNATC	1 cut(s)	54
BsaJI	CCNNGG	2 cut(s)	601, 664
BsaWI	WCCGGW	1 cut(s)	230
Bsc4I	CCNNNNNNNGG	2 cut(s)	160, 638
Bse1I	ACTGG	2 cut(s)	211, 737
Bse3DI	GCAATG	1 cut(s)	247
Bse8I	GATNNNNATC	1 cut(s)	54
BseAI	TCCGGA	1 cut(s)	230
BseBI	CCWGG	5 cut(s)	305, 330, 603, 648, 666
BseDI	CCNNGG	2 cut(s)	601, 664
BseJI	GATNNNNATC	1 cut(s)	54
BseLI	CCNNNNNNNGG	2 cut(s)	160, 638
BseMI	GCAATG	1 cut(s)	247
BseMII	CTCAG	1 cut(s)	456
BseNI	ACTGG	2 cut(s)	211, 737
BseXI	GCAGC	3 cut(s)	343, 562, 685
Bsh1285I	CGRYCG	1 cut(s)	150
BshFI	GGCC	2 cut(s)	337, 606
BsiEI	CGRYCG	1 cut(s)	150
BsiSI	CCGG	4 cut(s)	81, 111, 231, 554
BslFI	GGGAC	2 cut(s)	296, 717
BslI	CCNNNNNNNGG	2 cut(s)	160, 638
BsmFI	GGGAC	2 cut(s)	296, 717
BsnI	GGCC	2 cut(s)	337, 606
Bsp119I	TTCGAA	1 cut(s)	379
Bsp1286I	GDGCHC	1 cut(s)	128
Bsp13I	TCCGGA	1 cut(s)	230
Bsp143I	GATC	2 cut(s)	55, 233
BspACI	CCGC	8 cut(s)	29, 32, 107, 141, 150, 277, 526, 618
BspANI	GGCC	2 cut(s)	337, 606
BspCNI	CTCAG	1 cut(s)	457
BspEI	TCCGGA	1 cut(s)	230
BspLI	GGNNCC	2 cut(s)	127, 175
BspMAI	CTGCAG	2 cut(s)	441, 703
BspPI	GGATC	1 cut(s)	241
BspT104I	TTCGAA	1 cut(s)	379
BsrBI	CCGCTC	2 cut(s)	143, 526
BsrDI	GCAATG	1 cut(s)	247
BsrI	ACTGG	2 cut(s)	211, 737
BssECI	CCNNGG	2 cut(s)	601, 664
BssMI	GATC	2 cut(s)	55, 233
Bst2UI	CCWGG	5 cut(s)	305, 330, 603, 648, 666
BstAPI	GCANNNNNTGC	1 cut(s)	688
BstBAI	YACGTR	1 cut(s)	398
BstBI	TTCGAA	1 cut(s)	379
BstDEI	CTNAG	1 cut(s)	465
BstKTI	GATC	2 cut(s)	58, 236
BstMBI	GATC	2 cut(s)	55, 233
BstMCI	CGRYCG	1 cut(s)	150
BstMWI	GCNNNNNNNGC	5 cut(s)	11, 31, 149, 584, 688
BstNI	CCWGG	5 cut(s)	305, 330, 603, 648, 666
BstSCI	CCNGG	8 cut(s)	79, 109, 303, 328, 553, 601, 646, 664
BstSFI	CTRYAG	3 cut(s)	262, 437, 699
BstV1I	GCAGC	3 cut(s)	343, 562, 685
BstV2I	GAAGAC	1 cut(s)	37
BstXI	CCANNNNNNTGG	1 cut(s)	614
BsuI	GTATCC	1 cut(s)	653
BsuRI	GGCC	2 cut(s)	337, 606
Cfr13I	GGNCC	1 cut(s)	228
Csp6I	GTAC	2 cut(s)	315, 546
CviAII	CATG	3 cut(s)	637, 688, 722
CviQI	GTAC	2 cut(s)	315, 546
DdeI	CTNAG	1 cut(s)	465
DpnI	GATC	2 cut(s)	57, 235
DpnII	GATC	2 cut(s)	55, 233
EaeI	YGGCCR	1 cut(s)	604
Eco24I	GRGCYC	1 cut(s)	128
Eco32I	GATATC	1 cut(s)	644
Eco47I	GGWCC	1 cut(s)	228
Eco57I	CTGAAG	1 cut(s)	437
EcoRII	CCWGG	5 cut(s)	303, 328, 601, 646, 664
EcoRV	GATATC	1 cut(s)	644
EcoT38I	GRGCYC	1 cut(s)	128
FaeI	CATG	3 cut(s)	640, 691, 725
FaiI	YATR	7 cut(s)	54, 197, 362, 638, 677, 689, 723
FalI	AAGNNNNNCTT	2 cut(s)	504, 536
FaqI	GGGAC	2 cut(s)	296, 717
FatI	CATG	3 cut(s)	636, 687, 721
FauI	CCCGC	2 cut(s)	114, 148
Fnu4HI	GCNGC	6 cut(s)	6, 32, 357, 527, 576, 699
FriOI	GRGCYC	1 cut(s)	128
Fsp4HI	GCNGC	6 cut(s)	6, 32, 357, 527, 576, 699
GluI	GCNGC	6 cut(s)	6, 32, 357, 527, 576, 699
GsuI	CTGGAG	2 cut(s)	669, 687
HaeIII	GGCC	2 cut(s)	337, 606
HapII	CCGG	4 cut(s)	81, 111, 231, 554
Hin1II	CATG	3 cut(s)	640, 691, 725
HinfI	GANTC	5 cut(s)	131, 388, 422, 433, 580
HpaII	CCGG	4 cut(s)	81, 111, 231, 554
HphI	GGTGA	3 cut(s)	98, 397, 560
Hpy166II	GTNNAC	3 cut(s)	163, 548, 623
Hpy188I	TCNGA	5 cut(s)	60, 130, 147, 190, 417
Hpy188III	TCNNGA	4 cut(s)	101, 231, 482, 657
Hpy8I	GTNNAC	3 cut(s)	163, 548, 623
HpyAV	CCTTC	5 cut(s)	105, 193, 327, 412, 454
HpyCH4IV	ACGT	2 cut(s)	220, 397
HpyCH4V	TGCA	3 cut(s)	240, 439, 701
HpyF10VI	GCNNNNNNNGC	5 cut(s)	11, 31, 149, 584, 688
HpyF3I	CTNAG	1 cut(s)	465
HpySE526I	ACGT	2 cut(s)	220, 397
Hsp92II	CATG	3 cut(s)	640, 691, 725
Kpn2I	TCCGGA	1 cut(s)	230
Kzo9I	GATC	2 cut(s)	55, 233
LmnI	GCTCC	5 cut(s)	13, 131, 148, 179, 592
Lsp1109I	GCAGC	3 cut(s)	343, 562, 685
LweI	GCATC	3 cut(s)	78, 361, 618
MaeII	ACGT	2 cut(s)	220, 397
MaeIII	GTNAC	2 cut(s)	86, 393
MalI	GATC	2 cut(s)	57, 235
MbiI	CCGCTC	2 cut(s)	143, 526
MboI	GATC	2 cut(s)	55, 233
MboII	GAAGA	5 cut(s)	9, 12, 37, 457, 481
MhlI	GDGCHC	1 cut(s)	128
MlsI	TGGCCA	1 cut(s)	606
MluCI	AATT	5 cut(s)	37, 184, 308, 455, 531
MluNI	TGGCCA	1 cut(s)	606
MlyI	GAGTC	2 cut(s)	431, 442
MmeI	TCCRAC	1 cut(s)	170
MnlI	CCTC	4 cut(s)	219, 273, 489, 576
Mox20I	TGGCCA	1 cut(s)	606
MroI	TCCGGA	1 cut(s)	230
MscI	TGGCCA	1 cut(s)	606
MseI	TTAA	1 cut(s)	534
Msp20I	TGGCCA	1 cut(s)	606
MspI	CCGG	4 cut(s)	81, 111, 231, 554
MspR9I	CCNGG	8 cut(s)	81, 111, 305, 330, 555, 603, 648, 666
MvaI	CCWGG	5 cut(s)	305, 330, 603, 648, 666
MwoI	GCNNNNNNNGC	5 cut(s)	11, 31, 149, 584, 688
NciI	CCSGG	3 cut(s)	81, 111, 555
NdeII	GATC	2 cut(s)	55, 233
NlaIII	CATG	3 cut(s)	640, 691, 725
NlaIV	GGNNCC	2 cut(s)	127, 175
NmuCI	GTSAC	1 cut(s)	86
NspV	TTCGAA	1 cut(s)	379
PfeI	GAWTC	3 cut(s)	131, 388, 580
PfoI	TCCNGGA	2 cut(s)	303, 646
PkrI	GCNGC	6 cut(s)	7, 33, 358, 528, 577, 700
PleI	GAGTC	2 cut(s)	430, 441
PpsI	GAGTC	2 cut(s)	430, 441
Ppu21I	YACGTR	1 cut(s)	398
Psp6I	CCWGG	5 cut(s)	303, 328, 601, 646, 664
PspGI	CCWGG	5 cut(s)	303, 328, 601, 646, 664
PspN4I	GGNNCC	2 cut(s)	127, 175
PspPI	GGNCC	1 cut(s)	228
PstI	CTGCAG	2 cut(s)	441, 703
RsaI	GTAC	2 cut(s)	316, 547
RsaNI	GTAC	2 cut(s)	315, 546
SaqAI	TTAA	1 cut(s)	534
SatI	GCNGC	6 cut(s)	6, 32, 357, 527, 576, 699
Sau3AI	GATC	2 cut(s)	55, 233
Sau96I	GGNCC	1 cut(s)	228
ScaI	AGTACT	1 cut(s)	316
SchI	GAGTC	2 cut(s)	431, 442
ScrFI	CCNGG	8 cut(s)	81, 111, 305, 330, 555, 603, 648, 666
SduI	GDGCHC	1 cut(s)	128
SfaNI	GCATC	3 cut(s)	78, 361, 618
SfcI	CTRYAG	3 cut(s)	262, 437, 699
SfuI	TTCGAA	1 cut(s)	379
SinI	GGWCC	1 cut(s)	228
SmlI	CTYRAG	1 cut(s)	521
SmoI	CTYRAG	1 cut(s)	521
Sse9I	AATT	5 cut(s)	37, 184, 308, 455, 531
SsiI	CCGC	8 cut(s)	29, 32, 107, 141, 150, 277, 526, 618
StyD4I	CCNGG	8 cut(s)	79, 109, 303, 328, 553, 601, 646, 664
TaiI	ACGT	2 cut(s)	223, 400
TaqI	TCGA	4 cut(s)	48, 212, 379, 425
TasI	AATT	5 cut(s)	37, 184, 308, 455, 531
TatI	WGTACW	1 cut(s)	314
TauI	GCSGC	2 cut(s)	34, 529
TfiI	GAWTC	3 cut(s)	131, 388, 580
Tru1I	TTAA	1 cut(s)	534
Tru9I	TTAA	1 cut(s)	534
TseFI	GTSAC	1 cut(s)	86
TseI	GCWGC	4 cut(s)	5, 356, 575, 698
Tsp45I	GTSAC	1 cut(s)	86
TspDTI	ATGAA	3 cut(s)	212, 625, 676
TspGWI	ACGGA	1 cut(s)	719
VpaK11BI	GGWCC	1 cut(s)	228
XapI	RAATTY	1 cut(s)	184
ZrmI	AGTACT	1 cut(s)	316

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.