Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000554.1

Orthogroup ID

OG0011596

Physical Location & Seq

Genomic Coordinates Forward (+)

40071 .. 43118

Gene Structure 3048 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000554.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1032 bp

atgagatatcttactttattccatgtttcgcagcaacacagaccctacccgatctgcgccgttccgatcacattccacttctacaagtataacggataccaacgtgagattgatcctccgcgagaccttagtactgtttatattagccgaataacttttcagtacttacatgtacttagagtccatccctcatccaataggactgcggatctacgggatcagattgctacgctcctctccgactctatacgtgtcacagaagaggaccagtcaactataattgaaaagatatttcaggtgcttgccccggaccccgagctttgtatttttgttgatgtggttgaagtgactctgcagatagcggatgacattgacgcggttattgcaacggagtccttaagaacatatattcccaagcttattccggcaactaaatcatctattgaaggtttggagaaagtagggcttgatagcttggaaatcaaatctagtattgaactgacaccatcttgtgttatttgtatggaggaccttgattactctgcagaagaaggagagggggtagttgatcctgatcataaacgtcatgggatcctgatcactcgcatgccatgtttgcactattatcatgaagattgcatttctctctctggaattgacaaagatgaagtctatgcagcctccaaggagaaaagcgcctccgccttcatatctaactatacgaccttggattcaaagccttcgtcggcgactaagttgaagagtccgttgccgccaaggccgccgtcgtcaaatcaactcaaacgtaagctgggacgcttcctaagaactatgtccatgaagcctctggatctcttcgtcgagtgtgtttgcttggttgatgattctggtaattggacaatgcgtccatgtctctctagtgctgtgaagctttacccaaaggaggagatacatgaacggctactgagttttgctgaagctggagctactgttgtgagactaaaaggaggggatccactagtgagttcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_2

Protein Analysis

343

Amino Acids

38.57

Weight (kDa)

5.62

Isoelectric Point (pI)

47.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011596)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g26511 FvH4_7g26671
prunus_persica	Prupe.3G294900_v2.0.a1 Prupe.3G297500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0375041
rosa_laevigata	RLG00000022445 RLG00000022832 RLG00000026696
rosa_multiflora	Rmu_sc0000554.1_g000009 Rmu_sc0004112.1_g000017
rosa_roxburghii	Rroxscaffold_1G00045440
rosa_rugosa	Rorug01G0387700 Rorug04G0079200 Rorug06G0066400 Rorug06G0066500
rosa_samantha	Rh1AG398300 Rh1DG319000 Rh2DG446000
rosa_wichuraiana	Rw1G035350 Rw1G035360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	121, 377
AciI	CCGC	7 cut(s)	119, 206, 362, 377, 702, 773, 782
AclWI	GGATC	9 cut(s)	107, 216, 225, 563, 586, 599, 858, 1007, 1020
AcuI	CTGAAG	1 cut(s)	996
AfaI	GTAC	3 cut(s)	133, 164, 174
AfiI	CCNNNNNNNGG	1 cut(s)	943
AflII	CTTAAG	1 cut(s)	397
AflIII	ACRYGT	2 cut(s)	169, 250
AgsI	TTSAA	6 cut(s)	284, 344, 446, 497, 735, 760
AhdI	GACNNNNNGTC	1 cut(s)	903
AhlI	ACTAGT	1 cut(s)	1018
AloI	GAACNNNNNNTCC	2 cut(s)	394, 426
AluBI	AGCT	7 cut(s)	319, 418, 474, 811, 931, 980, 986
AluI	AGCT	7 cut(s)	319, 418, 474, 811, 931, 980, 986
Alw26I	GTCTC	3 cut(s)	117, 917, 991
AlwI	GGATC	9 cut(s)	107, 216, 225, 563, 586, 599, 858, 1007, 1020
Ama87I	CYCGRG	1 cut(s)	314
AoxI	GGCC	1 cut(s)	779
ApeKI	GCWGC	2 cut(s)	31, 677
ArsI	GACNNNNNNTTYG	4 cut(s)	654, 686, 728, 760
AspLEI	GCGC	2 cut(s)	59, 698
AspS9I	GGNCC	3 cut(s)	265, 310, 529
AsuC2I	CCSGG	1 cut(s)	308
AvaI	CYCGRG	1 cut(s)	314
AvaII	GGWCC	3 cut(s)	265, 310, 529
BaeI	ACNNNNGTAYC	2 cut(s)	88, 121
BamHI	GGATCC	2 cut(s)	591, 1012
BbvI	GCAGC	2 cut(s)	43, 689
BccI	CCATC	2 cut(s)	192, 514
BceAI	ACGGC	3 cut(s)	44, 769, 974
BciVI	GTATCC	1 cut(s)	89
BclI	TGATCA	2 cut(s)	574, 597
BcnI	CCSGG	1 cut(s)	308
BcoDI	GTCTC	3 cut(s)	117, 917, 991
BcuI	ACTAGT	1 cut(s)	1018
BfaI	CTAG	3 cut(s)	489, 918, 1019
BfmI	CTRYAG	2 cut(s)	353, 543
BfoI	RGCGCY	1 cut(s)	699
BfrI	CTTAAG	1 cut(s)	397
BfuI	GTATCC	1 cut(s)	89
BglI	GCCNNNNNGGC	1 cut(s)	778
BisI	GCNGC	4 cut(s)	32, 678, 773, 782
BlsI	GCNGC	4 cut(s)	33, 679, 774, 783
BmcAI	AGTACT	2 cut(s)	133, 164
Bme1390I	CCNGG	1 cut(s)	308
Bme18I	GGWCC	3 cut(s)	265, 310, 529
BmeRI	GACNNNNNGTC	1 cut(s)	903
BmeT110I	CYCGRG	1 cut(s)	314
BmgT120I	GGNCC	3 cut(s)	265, 310, 529
BmiI	GGNNCC	3 cut(s)	312, 593, 1014
BmrFI	CCNGG	1 cut(s)	308
BpmI	CTGGAG	1 cut(s)	1002
BpuMI	CCSGG	1 cut(s)	308
BsaAI	YACGTR	1 cut(s)	251
BsaBI	GATNNNNATC	2 cut(s)	573, 596
BsaI	GGTCTC	1 cut(s)	117
BsaJI	CCNNGG	4 cut(s)	306, 684, 726, 776
BsaXI	ACNNNNNCTCC	4 cut(s)	546, 576, 975, 1005
Bsc4I	CCNNNNNNNGG	1 cut(s)	943
Bse1I	ACTGG	1 cut(s)	268
Bse8I	GATNNNNATC	2 cut(s)	573, 596
BseDI	CCNNGG	4 cut(s)	306, 684, 726, 776
BseGI	GGATG	3 cut(s)	184, 191, 370
BseJI	GATNNNNATC	2 cut(s)	573, 596
BseLI	CCNNNNNNNGG	1 cut(s)	943
BseMII	CTCAG	1 cut(s)	956
BseNI	ACTGG	1 cut(s)	268
BseRI	GAGGAG	2 cut(s)	224, 959
BseXI	GCAGC	2 cut(s)	43, 689
BseYI	CCCAGC	1 cut(s)	811
Bsh1236I	CGCG	2 cut(s)	121, 377
BshFI	GGCC	1 cut(s)	781
BsiHKCI	CYCGRG	1 cut(s)	314
BsiSI	CCGG	2 cut(s)	308, 425
BslFI	GGGAC	1 cut(s)	828
BslI	CCNNNNNNNGG	1 cut(s)	943
BsmAI	GTCTC	3 cut(s)	117, 917, 991
BsmFI	GGGAC	1 cut(s)	828
BsnI	GGCC	1 cut(s)	781
Bso31I	GGTCTC	1 cut(s)	117
BsoBI	CYCGRG	1 cut(s)	314
BspACI	CCGC	7 cut(s)	119, 206, 362, 377, 702, 773, 782
BspANI	GGCC	1 cut(s)	781
BspCNI	CTCAG	1 cut(s)	957
BspFNI	CGCG	2 cut(s)	121, 377
BspHI	TCATGA	1 cut(s)	628
BspLI	GGNNCC	3 cut(s)	312, 593, 1014
BspMAI	CTGCAG	2 cut(s)	357, 547
BspPI	GGATC	9 cut(s)	107, 216, 225, 563, 586, 599, 858, 1007, 1020
BspTI	CTTAAG	1 cut(s)	397
BspTNI	GGTCTC	1 cut(s)	117
BsrI	ACTGG	1 cut(s)	268
BssECI	CCNNGG	4 cut(s)	306, 684, 726, 776
BssT1I	CCWWGG	3 cut(s)	684, 726, 776
Bst4CI	ACNGT	2 cut(s)	136, 991
Bst6I	CTCTTC	3 cut(s)	255, 755, 860
BstAFI	CTTAAG	1 cut(s)	397
BstBAI	YACGTR	1 cut(s)	251
BstC8I	GCNNGC	2 cut(s)	303, 608
BstDEI	CTNAG	6 cut(s)	128, 176, 753, 824, 965, 1029
BstF5I	GGATG	3 cut(s)	184, 191, 370
BstFNI	CGCG	2 cut(s)	121, 377
BstH2I	RGCGCY	1 cut(s)	699
BstHHI	GCGC	2 cut(s)	59, 698
BstMAI	GTCTC	3 cut(s)	117, 917, 991
BstMWI	GCNNNNNNNGC	4 cut(s)	383, 616, 778, 781
BstNSI	RCATGY	2 cut(s)	173, 610
BstSCI	CCNGG	1 cut(s)	306
BstSFI	CTRYAG	2 cut(s)	353, 543
BstUI	CGCG	2 cut(s)	121, 377
BstV1I	GCAGC	2 cut(s)	43, 689
BstX2I	RGATCY	4 cut(s)	208, 591, 850, 1012
BstYI	RGATCY	4 cut(s)	208, 591, 850, 1012
BsuI	GTATCC	1 cut(s)	89
BsuRI	GGCC	1 cut(s)	781
BtsCI	GGATG	3 cut(s)	184, 191, 370
Cac8I	GCNNGC	2 cut(s)	303, 608
CciI	TCATGA	1 cut(s)	628
CfoI	GCGC	2 cut(s)	59, 698
Cfr13I	GGNCC	3 cut(s)	265, 310, 529
CseI	GACGC	3 cut(s)	383, 825, 893
Csp6I	GTAC	3 cut(s)	132, 163, 173
CviAII	CATG	9 cut(s)	23, 170, 587, 607, 612, 629, 838, 909, 953
CviQI	GTAC	3 cut(s)	132, 163, 173
DdeI	CTNAG	6 cut(s)	128, 176, 753, 824, 965, 1029
DriI	GACNNNNNGTC	1 cut(s)	903
Eam1104I	CTCTTC	3 cut(s)	255, 755, 860
Eam1105I	GACNNNNNGTC	1 cut(s)	903
EarI	CTCTTC	3 cut(s)	255, 755, 860
EciI	GGCGGA	1 cut(s)	691
Eco130I	CCWWGG	3 cut(s)	684, 726, 776
Eco31I	GGTCTC	1 cut(s)	117
Eco32I	GATATC	1 cut(s)	8
Eco47I	GGWCC	3 cut(s)	265, 310, 529
Eco57I	CTGAAG	1 cut(s)	996
Eco88I	CYCGRG	1 cut(s)	314
EcoO109I	RGGNCCY	1 cut(s)	529
EcoRV	GATATC	1 cut(s)	8
EcoT14I	CCWWGG	3 cut(s)	684, 726, 776
ErhI	CCWWGG	3 cut(s)	684, 726, 776
FaeI	CATG	9 cut(s)	26, 173, 590, 610, 615, 632, 841, 912, 956
FalI	AAGNNNNNCTT	2 cut(s)	450, 482
FaqI	GGGAC	1 cut(s)	828
FatI	CATG	9 cut(s)	22, 169, 586, 606, 611, 628, 837, 908, 952
FbaI	TGATCA	2 cut(s)	574, 597
Fnu4HI	GCNGC	4 cut(s)	32, 678, 773, 782
FokI	GGATG	3 cut(s)	171, 178, 377
Fsp4HI	GCNGC	4 cut(s)	32, 678, 773, 782
FspBI	CTAG	3 cut(s)	489, 918, 1019
GlaI	GCGC	2 cut(s)	58, 697
GluI	GCNGC	4 cut(s)	32, 678, 773, 782
GsaI	CCCAGC	1 cut(s)	815
GsuI	CTGGAG	1 cut(s)	1002
HaeII	RGCGCY	1 cut(s)	699
HaeIII	GGCC	1 cut(s)	781
HapII	CCGG	2 cut(s)	308, 425
HgaI	GACGC	3 cut(s)	383, 825, 893
HhaI	GCGC	2 cut(s)	59, 698
Hin1II	CATG	9 cut(s)	26, 173, 590, 610, 615, 632, 841, 912, 956
Hin6I	GCGC	2 cut(s)	57, 696
HinP1I	GCGC	2 cut(s)	57, 696
HincII	GTYRAC	1 cut(s)	273
HindII	GTYRAC	1 cut(s)	273
HindIII	AAGCTT	2 cut(s)	416, 929
HinfI	GANTC	7 cut(s)	180, 242, 349, 392, 731, 763, 884
HpaII	CCGG	2 cut(s)	308, 425
Hpy166II	GTNNAC	1 cut(s)	273
Hpy188I	TCNGA	3 cut(s)	66, 222, 241
Hpy188III	TCNNGA	5 cut(s)	572, 595, 629, 651, 848
Hpy8I	GTNNAC	1 cut(s)	273
Hpy99I	CGWCG	3 cut(s)	748, 790, 863
HpyAV	CCTTC	4 cut(s)	440, 545, 715, 750
HpyCH4III	ACNGT	2 cut(s)	136, 991
HpyCH4IV	ACGT	4 cut(s)	103, 250, 583, 805
HpyCH4V	TGCA	6 cut(s)	355, 386, 545, 619, 639, 677
HpyF10VI	GCNNNNNNNGC	4 cut(s)	383, 616, 778, 781
HpyF3I	CTNAG	6 cut(s)	128, 176, 753, 824, 965, 1029
HpySE526I	ACGT	4 cut(s)	103, 250, 583, 805
Hsp92II	CATG	9 cut(s)	26, 173, 590, 610, 615, 632, 841, 912, 956
HspAI	GCGC	2 cut(s)	57, 696
Ksp22I	TGATCA	2 cut(s)	574, 597
LmnI	GCTCC	2 cut(s)	237, 983
Lsp1109I	GCAGC	2 cut(s)	43, 689
MaeI	CTAG	3 cut(s)	489, 918, 1019
MaeII	ACGT	4 cut(s)	103, 250, 583, 805
MaeIII	GTNAC	2 cut(s)	253, 346
MboII	GAAGA	5 cut(s)	272, 560, 644, 772, 847
MflI	RGATCY	4 cut(s)	208, 591, 850, 1012
MluCI	AATT	3 cut(s)	279, 654, 892
MlyI	GAGTC	5 cut(s)	189, 236, 343, 401, 772
MmeI	TCCRAC	1 cut(s)	264
MseI	TTAA	1 cut(s)	398
MslI	CAYNNNNRTG	1 cut(s)	605
MspCI	CTTAAG	1 cut(s)	397
MspI	CCGG	2 cut(s)	308, 425
MspR9I	CCNGG	1 cut(s)	308
MvnI	CGCG	2 cut(s)	121, 377
MwoI	GCNNNNNNNGC	4 cut(s)	383, 616, 778, 781
NciI	CCSGG	1 cut(s)	308
NlaIII	CATG	9 cut(s)	26, 173, 590, 610, 615, 632, 841, 912, 956
NlaIV	GGNNCC	3 cut(s)	312, 593, 1014
NmuCI	GTSAC	2 cut(s)	253, 346
NspI	RCATGY	2 cut(s)	173, 610
PaeI	GCATGC	1 cut(s)	610
PagI	TCATGA	1 cut(s)	628
PciI	ACATGT	1 cut(s)	169
PfeI	GAWTC	2 cut(s)	731, 884
PkrI	GCNGC	4 cut(s)	33, 679, 774, 783
PleI	GAGTC	5 cut(s)	188, 236, 343, 400, 771
PpsI	GAGTC	5 cut(s)	188, 236, 343, 400, 771
Ppu21I	YACGTR	1 cut(s)	251
PpuMI	RGGWCCY	1 cut(s)	529
PscI	ACATGT	1 cut(s)	169
Psp5II	RGGWCCY	1 cut(s)	529
PspFI	CCCAGC	1 cut(s)	811
PspN4I	GGNNCC	3 cut(s)	312, 593, 1014
PspPI	GGNCC	3 cut(s)	265, 310, 529
PspPPI	RGGWCCY	1 cut(s)	529
PstI	CTGCAG	2 cut(s)	357, 547
PsuI	RGATCY	4 cut(s)	208, 591, 850, 1012
RsaI	GTAC	3 cut(s)	133, 164, 174
RsaNI	GTAC	3 cut(s)	132, 163, 173
RseI	CAYNNNNRTG	1 cut(s)	605
SaqAI	TTAA	1 cut(s)	398
SatI	GCNGC	4 cut(s)	32, 678, 773, 782
Sau96I	GGNCC	3 cut(s)	265, 310, 529
ScaI	AGTACT	2 cut(s)	133, 164
SchI	GAGTC	5 cut(s)	189, 236, 343, 401, 772
ScrFI	CCNGG	1 cut(s)	308
SfcI	CTRYAG	2 cut(s)	353, 543
SinI	GGWCC	3 cut(s)	265, 310, 529
SmiMI	CAYNNNNRTG	1 cut(s)	605
SmlI	CTYRAG	1 cut(s)	397
SmoI	CTYRAG	1 cut(s)	397
SpeI	ACTAGT	1 cut(s)	1018
SphI	GCATGC	1 cut(s)	610
Sse9I	AATT	3 cut(s)	279, 654, 892
SsiI	CCGC	7 cut(s)	119, 206, 362, 377, 702, 773, 782
SspMI	CTAG	3 cut(s)	489, 918, 1019
StyD4I	CCNGG	1 cut(s)	306
StyI	CCWWGG	3 cut(s)	684, 726, 776
TaaI	ACNGT	2 cut(s)	136, 991
TaiI	ACGT	4 cut(s)	106, 253, 586, 808
TaqI	TCGA	1 cut(s)	861
TasI	AATT	3 cut(s)	279, 654, 892
TatI	WGTACW	3 cut(s)	131, 162, 172
TauI	GCSGC	2 cut(s)	775, 784
TfiI	GAWTC	2 cut(s)	731, 884
Tru1I	TTAA	1 cut(s)	398
Tru9I	TTAA	1 cut(s)	398
TseFI	GTSAC	2 cut(s)	253, 346
TseI	GCWGC	2 cut(s)	31, 677
Tsp45I	GTSAC	2 cut(s)	253, 346
TspDTI	ATGAA	5 cut(s)	645, 681, 697, 854, 969
TspGWI	ACGGA	3 cut(s)	108, 404, 756
Vha464I	CTTAAG	1 cut(s)	397
VpaK11BI	GGWCC	3 cut(s)	265, 310, 529
XceI	RCATGY	2 cut(s)	173, 610
XcmI	CCANNNNNNNNNTGG	1 cut(s)	844
XspI	CTAG	3 cut(s)	489, 918, 1019
ZrmI	AGTACT	2 cut(s)	133, 164

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.