Rroxscaffold_1G00045440

Adenosine kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
64419806 .. 64424749
4944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00045440.1

Sequence Viewer

Length: 267 bp
ATGTTAACAAACATGGATGAACTGTATGTGAAATCTAGATTTCATGAAATTTTTTACAAATTGGATCAATTGCTCTACAGAATTCAAGGGCCACCCACTGTGCGTGGAGAAAAGTTAAAGGGAGTGAAAAAACTTCTCTTGGTAATTGGTATAATGCGGTGTGTTTGCTTGGTTGATGAGTACGGCAATTGGACAATGCGTCCATGTCTCTCTAGTGTTGTGAAGCTTCACCCAAAGGTACATAATTCACAGCACATGTCTCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.29

Weight (kDa)

9.47

Isoelectric Point (pI)

14.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 157
AclWI GGATC 1 cut(s) 72
AcsI RAATTY 2 cut(s) 48, 81
AfaI GTAC 2 cut(s) 182, 240
AflIII ACRYGT 1 cut(s) 255
AgsI TTSAA 1 cut(s) 86
AhdI GACNNNNNGTC 1 cut(s) 198
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Alw26I GTCTC 1 cut(s) 212
AlwI GGATC 1 cut(s) 72
AoxI GGCC 1 cut(s) 89
ApoI RAATTY 2 cut(s) 48, 81
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 221
BceAI ACGGC 1 cut(s) 199
BcoDI GTCTC 1 cut(s) 212
BfaI CTAG 3 cut(s) 36, 213, 265
BfmI CTRYAG 1 cut(s) 76
BmeRI GACNNNNNGTC 1 cut(s) 198
BmgT120I GGNCC 1 cut(s) 89
BseGI GGATG 1 cut(s) 22
BshFI GGCC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 212
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 64
BspACI CCGC 1 cut(s) 157
BspANI GGCC 1 cut(s) 91
BspHI TCATGA 1 cut(s) 43
BspPI GGATC 1 cut(s) 72
BssMI GATC 1 cut(s) 64
Bst4CI ACNGT 2 cut(s) 24, 100
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 212
BstMBI GATC 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 259
BstSFI CTRYAG 1 cut(s) 76
BsuRI GGCC 1 cut(s) 91
BtsCI GGATG 1 cut(s) 22
BtsIMutI CAGTG 1 cut(s) 96
CciI TCATGA 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 89
CseI GACGC 1 cut(s) 188
Csp6I GTAC 2 cut(s) 181, 239
CviAII CATG 4 cut(s) 13, 44, 204, 256
CviJI RGCY 2 cut(s) 91, 226
CviKI_1 RGCY 2 cut(s) 91, 226
CviQI GTAC 2 cut(s) 181, 239
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
DriI GACNNNNNGTC 1 cut(s) 198
Eam1105I GACNNNNNGTC 1 cut(s) 198
EcoRI GAATTC 1 cut(s) 81
FaeI CATG 4 cut(s) 16, 47, 207, 259
FaiI YATR 7 cut(s) 14, 27, 45, 152, 205, 243, 257
FatI CATG 4 cut(s) 12, 43, 203, 255
FokI GGATG 1 cut(s) 29
FspBI CTAG 3 cut(s) 36, 213, 265
HaeIII GGCC 1 cut(s) 91
HgaI GACGC 1 cut(s) 188
Hin1II CATG 4 cut(s) 16, 47, 207, 259
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 224
HpaI GTTAAC 1 cut(s) 6
HphI GGTGA 1 cut(s) 221
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 2 cut(s) 36, 44
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 2 cut(s) 24, 100
Hsp92II CATG 4 cut(s) 16, 47, 207, 259
KspAI GTTAAC 1 cut(s) 6
Kzo9I GATC 1 cut(s) 64
MaeI CTAG 3 cut(s) 36, 213, 265
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MfeI CAATTG 2 cut(s) 68, 187
MluCI AATT 7 cut(s) 48, 59, 68, 81, 144, 187, 244
MseI TTAA 2 cut(s) 5, 116
MunI CAATTG 2 cut(s) 68, 187
NdeII GATC 1 cut(s) 64
NlaIII CATG 4 cut(s) 16, 47, 207, 259
NspI RCATGY 1 cut(s) 259
PagI TCATGA 1 cut(s) 43
PciI ACATGT 1 cut(s) 255
PscI ACATGT 1 cut(s) 255
PspPI GGNCC 1 cut(s) 89
RsaI GTAC 2 cut(s) 182, 240
RsaNI GTAC 2 cut(s) 181, 239
SaqAI TTAA 2 cut(s) 5, 116
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 89
SetI ASST 2 cut(s) 228, 240
SfcI CTRYAG 1 cut(s) 76
SgeI CNNG 9 cut(s) 25, 48, 56, 98, 116, 151, 181, 216, 225
Sse9I AATT 7 cut(s) 48, 59, 68, 81, 144, 187, 244
SsiI CCGC 1 cut(s) 157
SspMI CTAG 3 cut(s) 36, 213, 265
TaaI ACNGT 2 cut(s) 24, 100
TasI AATT 7 cut(s) 48, 59, 68, 81, 144, 187, 244
Tru1I TTAA 2 cut(s) 5, 116
Tru9I TTAA 2 cut(s) 5, 116
TscAI CASTG 1 cut(s) 103
TspDTI ATGAA 3 cut(s) 32, 33, 60
TspRI CASTG 1 cut(s) 103
XapI RAATTY 2 cut(s) 48, 81
XbaI TCTAGA 1 cut(s) 35
XceI RCATGY 1 cut(s) 259
XspI CTAG 3 cut(s) 36, 213, 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.