Rmu_sc0000596.1_g000027

UPF0496 protein At4g34320-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000596.1
Physical Location & Seq
Forward (+)
153860 .. 154720
861 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000596.1_g000027.1.cds

Sequence Viewer

Length: 861 bp
atgggaatgaagggagtgagaaagttaagtcgaaagatcttcaaaaacgtttgcaatcgtgatggagatctctggagatcatacgaggacgcttgcaagaatgaaaaggatttcttaactgaactgggcaagttcctagagtcgtatgagaaaagttcgattcaaattaagaaggtgaaaaacaacgacggaggcaatgatgatggttacatgaggattttggagaaattgaagaatgtcaagggggcctcaggtagagtctatgatcagcattttgcacatcaaattttgcgcgaacaggttgaatgtttgaagacgcagcgagaagatttgcatgacgaattgacaggccaaaaagaaaagcctcgcaagaagtatgattgcactcgtgcttggagacactgtttgaggatggtcactcatatattgttcattggtgctgcagctgctgagtttgcctgcacagttgtggcggcagttttggctgctccacttgttgcactggccattgccgccgctattatcccaacactagccggacagcattggactctgtcttggattgaagattcggaaatttcttcagggtattctgactctgtaattcgcttaatggaatccaaaactatgcgttccattaaggatttgggagaaattcagacgtatctctgtcgtgttgtaaaggacaaagaatcactcacatccgatctcaattctgtaattgacggagatgaagatatcaacatgaacactattgagcgtcttctgaaggacattaatgagttgaaggaaagagcaaggaatagcaagtccaagatattggaggcaagcaaggaggtttctaagaagataaaagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

286

Amino Acids

32.53

Weight (kDa)

8.68

Isoelectric Point (pI)

35.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 294
AciI CCGC 3 cut(s) 473, 513, 516
AclI AACGTT 1 cut(s) 48
AcoI YGGCCR 1 cut(s) 504
AcsI RAATTY 3 cut(s) 285, 576, 654
AcuI CTGAAG 2 cut(s) 567, 788
AgsI TTSAA 7 cut(s) 43, 164, 232, 305, 313, 566, 787
AleI CACNNNNGTG 1 cut(s) 467
AluBI AGCT 1 cut(s) 446
AluI AGCT 1 cut(s) 446
Alw26I GTCTC 1 cut(s) 391
AlwNI CAGNNNCTG 1 cut(s) 449
AoxI GGCC 3 cut(s) 246, 349, 504
ApeKI GCWGC 5 cut(s) 319, 440, 443, 446, 485
ApoI RAATTY 3 cut(s) 285, 576, 654
AseI ATTAAT 1 cut(s) 777
AspLEI GCGC 1 cut(s) 294
AspS9I GGNCC 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 187
AxyI CCTNAGG 1 cut(s) 250
BalI TGGCCA 1 cut(s) 506
BauI CACGAG 1 cut(s) 387
BbsI GAAGAC 2 cut(s) 320, 755
BbvI GCAGC 5 cut(s) 331, 427, 433, 455, 472
BccI CCATC 3 cut(s) 56, 197, 406
BclI TGATCA 1 cut(s) 265
BcoDI GTCTC 1 cut(s) 391
BfaI CTAG 2 cut(s) 137, 533
BfmI CTRYAG 1 cut(s) 441
BglII AGATCT 2 cut(s) 36, 67
BisI GCNGC 8 cut(s) 320, 441, 444, 447, 474, 486, 513, 516
BlsI GCNGC 8 cut(s) 321, 442, 445, 448, 475, 487, 514, 517
BmgT120I GGNCC 1 cut(s) 246
BmiI GGNNCC 1 cut(s) 247
BmrI ACTGGG 1 cut(s) 134
BmuI ACTGGG 1 cut(s) 134
BpiI GAAGAC 2 cut(s) 320, 755
BpmI CTGGAG 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 66
BsaXI ACNNNNNCTCC 2 cut(s) 388, 418
Bse1I ACTGG 2 cut(s) 129, 507
Bse21I CCTNAGG 1 cut(s) 250
Bse3DI GCAATG 2 cut(s) 202, 507
Bse8I GATNNNNATC 1 cut(s) 66
BseGI GGATG 2 cut(s) 417, 701
BseJI GATNNNNATC 1 cut(s) 66
BseMI GCAATG 2 cut(s) 202, 507
BseMII CTCAG 2 cut(s) 264, 441
BseNI ACTGG 2 cut(s) 129, 507
BseXI GCAGC 5 cut(s) 331, 427, 433, 455, 472
BsgI GTGCAG 1 cut(s) 445
Bsh1236I CGCG 1 cut(s) 294
BshFI GGCC 3 cut(s) 248, 351, 506
BsiSI CCGG 1 cut(s) 537
BsmAI GTCTC 1 cut(s) 391
BsnI GGCC 3 cut(s) 248, 351, 506
Bsp143I GATC 5 cut(s) 36, 67, 77, 265, 706
BspACI CCGC 3 cut(s) 473, 513, 516
BspANI GGCC 3 cut(s) 248, 351, 506
BspCNI CTCAG 2 cut(s) 263, 442
BspFNI CGCG 1 cut(s) 294
BspLI GGNNCC 1 cut(s) 247
BspMAI CTGCAG 1 cut(s) 445
BsrDI GCAATG 2 cut(s) 202, 507
BsrI ACTGG 2 cut(s) 129, 507
BssMI GATC 5 cut(s) 36, 67, 77, 265, 706
BssSI CACGAG 1 cut(s) 387
Bst2BI CACGAG 1 cut(s) 387
Bst4CI ACNGT 2 cut(s) 404, 466
BstC8I GCNNGC 3 cut(s) 94, 460, 829
BstDEI CTNAG 3 cut(s) 250, 450, 843
BstF5I GGATG 2 cut(s) 417, 701
BstFNI CGCG 1 cut(s) 294
BstHHI GCGC 1 cut(s) 294
BstKTI GATC 5 cut(s) 39, 70, 80, 268, 709
BstMAI GTCTC 1 cut(s) 391
BstMBI GATC 5 cut(s) 36, 67, 77, 265, 706
BstMWI GCNNNNNNNGC 4 cut(s) 446, 455, 482, 512
BstSFI CTRYAG 1 cut(s) 441
BstUI CGCG 1 cut(s) 294
BstV1I GCAGC 5 cut(s) 331, 427, 433, 455, 472
BstV2I GAAGAC 2 cut(s) 320, 755
BstX2I RGATCY 2 cut(s) 36, 67
BstXI CCANNNNNNTGG 1 cut(s) 820
BstYI RGATCY 2 cut(s) 36, 67
Bsu36I CCTNAGG 1 cut(s) 250
BsuRI GGCC 3 cut(s) 248, 351, 506
BtsCI GGATG 2 cut(s) 417, 701
BtsIMutI CAGTG 2 cut(s) 400, 500
Cac8I GCNNGC 3 cut(s) 94, 460, 829
CaiI CAGNNNCTG 1 cut(s) 449
CfoI GCGC 1 cut(s) 294
Cfr13I GGNCC 1 cut(s) 246
CseI GACGC 3 cut(s) 98, 325, 749
CviAII CATG 3 cut(s) 211, 335, 745
CviJI RGCY 7 cut(s) 248, 351, 364, 446, 485, 506, 536
CviKI_1 RGCY 7 cut(s) 248, 351, 364, 446, 485, 506, 536
DdeI CTNAG 3 cut(s) 250, 450, 843
DpnI GATC 5 cut(s) 38, 69, 79, 267, 708
DpnII GATC 5 cut(s) 36, 67, 77, 265, 706
EaeI YGGCCR 1 cut(s) 504
Eco32I GATATC 1 cut(s) 739
Eco57I CTGAAG 2 cut(s) 567, 788
Eco81I CCTNAGG 1 cut(s) 250
EcoO109I RGGNCCY 1 cut(s) 246
EcoRV GATATC 1 cut(s) 739
FaeI CATG 3 cut(s) 214, 338, 748
FalI AAGNNNNNCTT 2 cut(s) 98, 130
FatI CATG 3 cut(s) 210, 334, 744
FbaI TGATCA 1 cut(s) 265
Fnu4HI GCNGC 8 cut(s) 320, 441, 444, 447, 474, 486, 513, 516
FokI GGATG 2 cut(s) 424, 688
Fsp4HI GCNGC 8 cut(s) 320, 441, 444, 447, 474, 486, 513, 516
FspBI CTAG 2 cut(s) 137, 533
GlaI GCGC 1 cut(s) 293
GluI GCNGC 8 cut(s) 320, 441, 444, 447, 474, 486, 513, 516
GsuI CTGGAG 1 cut(s) 94
HaeIII GGCC 3 cut(s) 248, 351, 506
HapII CCGG 1 cut(s) 537
HgaI GACGC 3 cut(s) 98, 325, 749
HhaI GCGC 1 cut(s) 294
Hin1II CATG 3 cut(s) 214, 338, 748
Hin6I GCGC 1 cut(s) 292
HinP1I GCGC 1 cut(s) 292
HinfI GANTC 8 cut(s) 140, 160, 258, 550, 569, 596, 617, 692
HpaII CCGG 1 cut(s) 537
HphI GGTGA 1 cut(s) 187
Hpy188I TCNGA 5 cut(s) 574, 595, 660, 706, 768
Hpy188III TCNNGA 2 cut(s) 59, 73
Hpy99I CGWCG 1 cut(s) 191
HpyAV CCTTC 4 cut(s) 4, 166, 763, 781
HpyCH4III ACNGT 2 cut(s) 404, 466
HpyCH4IV ACGT 2 cut(s) 48, 662
HpyCH4V TGCA 8 cut(s) 54, 96, 278, 334, 384, 443, 462, 500
HpyF10VI GCNNNNNNNGC 4 cut(s) 446, 455, 482, 512
HpyF3I CTNAG 3 cut(s) 250, 450, 843
HpySE526I ACGT 2 cut(s) 48, 662
Hsp92II CATG 3 cut(s) 214, 338, 748
HspAI GCGC 1 cut(s) 292
Ksp22I TGATCA 1 cut(s) 265
Kzo9I GATC 5 cut(s) 36, 67, 77, 265, 706
LmnI GCTCC 1 cut(s) 493
LpnPI CCDG 9 cut(s) 58, 110, 237, 284, 333, 472, 488, 550, 570
Lsp1109I GCAGC 5 cut(s) 331, 427, 433, 455, 472
MaeI CTAG 2 cut(s) 137, 533
MaeII ACGT 2 cut(s) 48, 662
MaeIII GTNAC 2 cut(s) 206, 415
MalI GATC 5 cut(s) 38, 69, 79, 267, 708
MboI GATC 5 cut(s) 36, 67, 77, 265, 706
MboII GAAGA 9 cut(s) 31, 244, 325, 338, 573, 578, 746, 755, 859
MflI RGATCY 2 cut(s) 36, 67
MlsI TGGCCA 1 cut(s) 506
MluCI AATT 9 cut(s) 165, 227, 285, 341, 576, 603, 654, 712, 720
MluNI TGGCCA 1 cut(s) 506
MlyI GAGTC 4 cut(s) 149, 267, 544, 590
MnlI CCTC 8 cut(s) 79, 185, 207, 259, 375, 402, 817, 829
Mox20I TGGCCA 1 cut(s) 506
MscI TGGCCA 1 cut(s) 506
MseI TTAA 6 cut(s) 26, 116, 168, 611, 639, 777
MslI CAYNNNNRTG 1 cut(s) 467
Msp20I TGGCCA 1 cut(s) 506
MspA1I CMGCKG 1 cut(s) 446
MspI CCGG 1 cut(s) 537
MvnI CGCG 1 cut(s) 294
MwoI GCNNNNNNNGC 4 cut(s) 446, 455, 482, 512
NdeII GATC 5 cut(s) 36, 67, 77, 265, 706
NlaIII CATG 3 cut(s) 214, 338, 748
NlaIV GGNNCC 1 cut(s) 247
NmuCI GTSAC 1 cut(s) 415
OliI CACNNNNGTG 1 cut(s) 467
PfeI GAWTC 4 cut(s) 160, 569, 617, 692
PflFI GACNNNGTC 1 cut(s) 553
PkrI GCNGC 8 cut(s) 321, 442, 445, 448, 475, 487, 514, 517
PleI GAGTC 4 cut(s) 148, 266, 544, 590
PpsI GAGTC 4 cut(s) 148, 266, 544, 590
PshBI ATTAAT 1 cut(s) 777
Psp1406I AACGTT 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 247
PspPI GGNCC 1 cut(s) 246
PstI CTGCAG 1 cut(s) 445
PstNI CAGNNNCTG 1 cut(s) 449
PsuI RGATCY 2 cut(s) 36, 67
PsyI GACNNNGTC 1 cut(s) 553
PvuII CAGCTG 1 cut(s) 446
RseI CAYNNNNRTG 1 cut(s) 467
SaqAI TTAA 6 cut(s) 26, 116, 168, 611, 639, 777
SatI GCNGC 8 cut(s) 320, 441, 444, 447, 474, 486, 513, 516
Sau3AI GATC 5 cut(s) 36, 67, 77, 265, 706
Sau96I GGNCC 1 cut(s) 246
SchI GAGTC 4 cut(s) 149, 267, 544, 590
SetI ASST 7 cut(s) 51, 177, 256, 303, 448, 665, 840
SfcI CTRYAG 1 cut(s) 441
SmiMI CAYNNNNRTG 1 cut(s) 467
Sse9I AATT 9 cut(s) 165, 227, 285, 341, 576, 603, 654, 712, 720
SsiI CCGC 3 cut(s) 473, 513, 516
SspMI CTAG 2 cut(s) 137, 533
TaaI ACNGT 2 cut(s) 404, 466
TaiI ACGT 2 cut(s) 51, 665
TaqI TCGA 2 cut(s) 31, 158
TasI AATT 9 cut(s) 165, 227, 285, 341, 576, 603, 654, 712, 720
TauI GCSGC 3 cut(s) 476, 515, 518
TfiI GAWTC 4 cut(s) 160, 569, 617, 692
Tru1I TTAA 6 cut(s) 26, 116, 168, 611, 639, 777
Tru9I TTAA 6 cut(s) 26, 116, 168, 611, 639, 777
TscAI CASTG 2 cut(s) 407, 507
TseFI GTSAC 1 cut(s) 415
TseI GCWGC 5 cut(s) 319, 440, 443, 446, 485
Tsp45I GTSAC 1 cut(s) 415
TspDTI ATGAA 5 cut(s) 23, 117, 421, 747, 761
TspGWI ACGGA 2 cut(s) 204, 741
TspRI CASTG 2 cut(s) 407, 507
Tth111I GACNNNGTC 1 cut(s) 553
VspI ATTAAT 1 cut(s) 777
XapI RAATTY 3 cut(s) 285, 576, 654
XcmI CCANNNNNNNNNTGG 1 cut(s) 643
XspI CTAG 2 cut(s) 137, 533
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.