Rmu_sc0000607.1_g000026

Nicotinate-nucleotide pyrophosphorylase carboxylating

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000607.1
Physical Location & Seq
Reverse (-)
129164 .. 129478
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000607.1_g000026.1.cds

Sequence Viewer

Length: 231 bp
atggaagtagaagcccacttcttggcaaaggagaattgtatagttgctggaattgcacttgcagagatggtattttataaagttgatcccactctaaaggttgagtggtcacaaaaggatggagactccgtacataaaggcttagagtctggaaaagtttatggtaactccggagtatcagtaatctttcttgtcctagttgtttatggggattttgctatagacagctag

Protein Analysis

76

Amino Acids

8.27

Weight (kDa)

4.71

Isoelectric Point (pI)

5.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 78
AccB7I CCANNNNNTGG 1 cut(s) 22
AccIII TCCGGA 1 cut(s) 170
AclWI GGATC 1 cut(s) 80
AfaI GTAC 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 22
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 80
Aor13HI TCCGGA 1 cut(s) 170
BccI CCATC 2 cut(s) 61, 113
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 2 cut(s) 197, 229
BfmI CTRYAG 1 cut(s) 219
BsaWI WCCGGW 1 cut(s) 170
BsaXI ACNNNNNCTCC 4 cut(s) 114, 144, 165, 195
Bsc4I CCNNNNNNNGG 1 cut(s) 22
BseAI TCCGGA 1 cut(s) 170
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 22
BsiSI CCGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 117
Bsp13I TCCGGA 1 cut(s) 170
Bsp143I GATC 1 cut(s) 85
BspEI TCCGGA 1 cut(s) 170
BspPI GGATC 1 cut(s) 80
BssMI GATC 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 142
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 88
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 85
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 219
BtsCI GGATG 1 cut(s) 124
Csp6I GTAC 1 cut(s) 131
CviJI RGCY 3 cut(s) 14, 141, 228
CviKI_1 RGCY 3 cut(s) 14, 141, 228
CviQI GTAC 1 cut(s) 131
DdeI CTNAG 1 cut(s) 142
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
FaiI YATR 6 cut(s) 41, 78, 135, 162, 207, 221
FokI GGATG 1 cut(s) 131
FspBI CTAG 2 cut(s) 197, 229
HapII CCGG 1 cut(s) 171
HinfI GANTC 2 cut(s) 125, 146
HpaII CCGG 1 cut(s) 171
Hpy188III TCNNGA 2 cut(s) 150, 171
HpyCH4V TGCA 2 cut(s) 56, 62
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 142
Kpn2I TCCGGA 1 cut(s) 170
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 3 cut(s) 33, 135, 184
MaeI CTAG 2 cut(s) 197, 229
MaeIII GTNAC 2 cut(s) 108, 164
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MluCI AATT 2 cut(s) 34, 51
MlyI GAGTC 2 cut(s) 119, 155
MroI TCCGGA 1 cut(s) 170
MspI CCGG 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 1 cut(s) 85
NmuCI GTSAC 1 cut(s) 108
PflMI CCANNNNNTGG 1 cut(s) 22
PleI GAGTC 2 cut(s) 119, 154
PpsI GAGTC 2 cut(s) 119, 154
PsiI TTATAA 1 cut(s) 78
RsaI GTAC 1 cut(s) 132
RsaNI GTAC 1 cut(s) 131
Sau3AI GATC 1 cut(s) 85
SchI GAGTC 2 cut(s) 119, 155
SetI ASST 2 cut(s) 102, 230
SfcI CTRYAG 1 cut(s) 219
SgeI CNNG 7 cut(s) 34, 60, 71, 162, 183, 203, 209
Sse9I AATT 2 cut(s) 34, 51
SspMI CTAG 2 cut(s) 197, 229
TasI AATT 2 cut(s) 34, 51
TseFI GTSAC 1 cut(s) 108
Tsp45I GTSAC 1 cut(s) 108
TspGWI ACGGA 1 cut(s) 118
Van91I CCANNNNNTGG 1 cut(s) 22
XspI CTAG 2 cut(s) 197, 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.