Rh2BG243400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
24507129 .. 24508020
892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG243400.1

Sequence Viewer

Length: 177 bp
ATGGTTGTGAATTTCGCAGATGTACATGGACGACATAAGGCTGTCTTCATCCGCAAGGACCACCGCCTCATCGTCAACATCTCCGATCTCCACTTCTTCGGCGACATCGGCAATAGTATAAATGATGCTCAGGACTTAACTGATGAAAGAAGGTACATTGATCAGCGAACAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.81

Weight (kDa)

6.9

Isoelectric Point (pI)

26.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 52, 64
AcsI RAATTY 1 cut(s) 10
AfaI GTAC 2 cut(s) 24, 155
ApoI RAATTY 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 58
AvaII GGWCC 1 cut(s) 58
BbsI GAAGAC 1 cut(s) 37
BclI TGATCA 1 cut(s) 160
Bme18I GGWCC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 58
BmsI GCATC 1 cut(s) 115
BpiI GAAGAC 1 cut(s) 37
Bpu10I CCTNAGC 1 cut(s) 129
BseGI GGATG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 143
Bsp1407I TGTACA 1 cut(s) 22
Bsp143I GATC 2 cut(s) 85, 160
BspACI CCGC 2 cut(s) 52, 64
BspCNI CTCAG 1 cut(s) 142
BsrGI TGTACA 1 cut(s) 22
BssMI GATC 2 cut(s) 85, 160
BstAUI TGTACA 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 48
BstKTI GATC 2 cut(s) 88, 163
BstMBI GATC 2 cut(s) 85, 160
BstMWI GCNNNNNNNGC 1 cut(s) 108
BstV2I GAAGAC 1 cut(s) 37
BtsCI GGATG 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 58
Csp6I GTAC 2 cut(s) 23, 154
CviAII CATG 1 cut(s) 26
CviJI RGCY 1 cut(s) 41
CviKI_1 RGCY 1 cut(s) 41
CviQI GTAC 2 cut(s) 23, 154
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 87, 162
DpnII GATC 2 cut(s) 85, 160
Eco47I GGWCC 1 cut(s) 58
FaeI CATG 1 cut(s) 29
FaiI YATR 3 cut(s) 27, 36, 119
FalI AAGNNNNNCTT 2 cut(s) 29, 61
FatI CATG 1 cut(s) 25
FbaI TGATCA 1 cut(s) 160
FokI GGATG 1 cut(s) 35
Hin1II CATG 1 cut(s) 29
HincII GTYRAC 1 cut(s) 76
HindII GTYRAC 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 76
HpyAV CCTTC 1 cut(s) 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 108
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 1 cut(s) 29
Ksp22I TGATCA 1 cut(s) 160
Kzo9I GATC 2 cut(s) 85, 160
LpnPI CCDG 1 cut(s) 116
LweI GCATC 1 cut(s) 115
MalI GATC 2 cut(s) 87, 162
MboI GATC 2 cut(s) 85, 160
MboII GAAGA 2 cut(s) 37, 88
MluCI AATT 1 cut(s) 10
MnlI CCTC 1 cut(s) 77
MseI TTAA 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 108
NdeII GATC 2 cut(s) 85, 160
NlaIII CATG 1 cut(s) 29
PspPI GGNCC 1 cut(s) 58
RsaI GTAC 2 cut(s) 24, 155
RsaNI GTAC 2 cut(s) 23, 154
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 2 cut(s) 85, 160
Sau96I GGNCC 1 cut(s) 58
SetI ASST 1 cut(s) 155
SfaNI GCATC 1 cut(s) 115
SgeI CNNG 3 cut(s) 38, 67, 143
SinI GGWCC 1 cut(s) 58
Sse9I AATT 1 cut(s) 10
SsiI CCGC 2 cut(s) 52, 64
TasI AATT 1 cut(s) 10
TatI WGTACW 1 cut(s) 22
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TspDTI ATGAA 2 cut(s) 37, 159
VpaK11BI GGWCC 1 cut(s) 58
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.