Rh2BG059800

Transmembrane protein 205

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0002675
Physical Location & Seq
Reverse (-)
4488385 .. 4492153
3769 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG059800.1

Sequence Viewer

Length: 387 bp
ATGGACGACATCAAGGCAGTCCTCGATCGCAAGGACCACTGCCTCAACGTCAACAACTCCGATCTCCACTTCTTTGGCGACCTCGGCAATAGGAGACTGCTTCAGAGGATTGTGCTCGAAGCCCTCCATGAGAGAATCACTGCTCTGCGGTGGGAGTCTGCTCTCAAGATGATGAAGCAGAGGCATAAGATCGAGAGGGAACAGAACATTGGGATGAAGCAGAGGCATAAGATCGAGAGGGAACAGAACATTGGGGAAGAAGTTGGATGGTCCAAAAATGTGAAAGTTGCAAAGGTGAACCCTAGTGGTTGTTATTCAATCCAATTCATGATCTTATCAAGAACCATGTTACAATACTCAGTGACAAAAGAAAAAGATCTTACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4149

Protein Analysis

128

Amino Acids

15.09

Weight (kDa)

9.51

Isoelectric Point (pI)

55.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 318
AjuI GAANNNNNNNTTGG 4 cut(s) 192, 224, 234, 266
Alw21I GWGCWC 1 cut(s) 117
Alw26I GTCTC 1 cut(s) 88
AspS9I GGNCC 2 cut(s) 34, 270
AsuHPI GGTGA 1 cut(s) 307
AvaII GGWCC 2 cut(s) 34, 270
Bbv12I GWGCWC 1 cut(s) 117
BccI CCATC 1 cut(s) 261
BcoDI GTCTC 1 cut(s) 88
BfaI CTAG 1 cut(s) 303
BglII AGATCT 1 cut(s) 376
Bme18I GGWCC 2 cut(s) 34, 270
BmgT120I GGNCC 2 cut(s) 34, 270
BpuEI CTTGAG 1 cut(s) 149
BsaJI CCNNGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 82
BseGI GGATG 2 cut(s) 219, 272
BseMII CTCAG 1 cut(s) 372
Bsh1285I CGRYCG 1 cut(s) 28
BsiEI CGRYCG 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 117
BsmAI GTCTC 1 cut(s) 88
Bsp1286I GDGCHC 1 cut(s) 117
Bsp143I GATC 6 cut(s) 25, 61, 189, 231, 330, 376
BspACI CCGC 1 cut(s) 148
BspCNI CTCAG 1 cut(s) 371
BspHI TCATGA 1 cut(s) 327
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 6 cut(s) 25, 61, 189, 231, 330, 376
BstDEI CTNAG 1 cut(s) 358
BstF5I GGATG 2 cut(s) 219, 272
BstKTI GATC 6 cut(s) 28, 64, 192, 234, 333, 379
BstMAI GTCTC 1 cut(s) 88
BstMBI GATC 6 cut(s) 25, 61, 189, 231, 330, 376
BstMCI CGRYCG 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 84
BstX2I RGATCY 1 cut(s) 376
BstXI CCANNNNNNTGG 1 cut(s) 74
BstYI RGATCY 1 cut(s) 376
BtsCI GGATG 2 cut(s) 219, 272
BtsI GCAGTG 2 cut(s) 37, 138
BtsIMutI CAGTG 3 cut(s) 37, 138, 366
CciI TCATGA 1 cut(s) 327
Cfr13I GGNCC 2 cut(s) 34, 270
CviAII CATG 3 cut(s) 128, 328, 346
CviJI RGCY 1 cut(s) 122
CviKI_1 RGCY 1 cut(s) 122
DdeI CTNAG 1 cut(s) 358
DpnI GATC 6 cut(s) 27, 63, 191, 233, 332, 378
DpnII GATC 6 cut(s) 25, 61, 189, 231, 330, 376
Eco47I GGWCC 2 cut(s) 34, 270
Eco57I CTGAAG 1 cut(s) 86
FaeI CATG 3 cut(s) 131, 331, 349
FaiI YATR 5 cut(s) 129, 186, 228, 329, 347
FatI CATG 3 cut(s) 127, 327, 345
FokI GGATG 2 cut(s) 226, 279
FspBI CTAG 1 cut(s) 303
Hin1II CATG 3 cut(s) 131, 331, 349
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 2 cut(s) 135, 155
HphI GGTGA 1 cut(s) 307
Hpy166II GTNNAC 2 cut(s) 52, 298
Hpy188I TCNGA 2 cut(s) 61, 105
Hpy188III TCNNGA 5 cut(s) 166, 193, 235, 328, 339
Hpy8I GTNNAC 2 cut(s) 52, 298
HpyCH4IV ACGT 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 84
HpyF3I CTNAG 1 cut(s) 358
HpySE526I ACGT 1 cut(s) 48
Hsp92II CATG 3 cut(s) 131, 331, 349
Kzo9I GATC 6 cut(s) 25, 61, 189, 231, 330, 376
MaeI CTAG 1 cut(s) 303
MaeII ACGT 1 cut(s) 48
MaeIII GTNAC 2 cut(s) 348, 361
MalI GATC 6 cut(s) 27, 63, 191, 233, 332, 378
MboI GATC 6 cut(s) 25, 61, 189, 231, 330, 376
MboII GAAGA 1 cut(s) 269
MflI RGATCY 1 cut(s) 376
MhlI GDGCHC 1 cut(s) 117
MluCI AATT 1 cut(s) 323
MlyI GAGTC 1 cut(s) 164
MmeI TCCRAC 1 cut(s) 244
MnlI CCTC 9 cut(s) 32, 53, 92, 99, 134, 174, 189, 216, 231
MslI CAYNNNNRTG 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 84
NdeII GATC 6 cut(s) 25, 61, 189, 231, 330, 376
NlaIII CATG 3 cut(s) 131, 331, 349
NmeAIII GCCGAG 1 cut(s) 63
NmuCI GTSAC 1 cut(s) 361
PagI TCATGA 1 cut(s) 327
PfeI GAWTC 1 cut(s) 135
Ple19I CGATCG 1 cut(s) 28
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
PspPI GGNCC 2 cut(s) 34, 270
PsuI RGATCY 1 cut(s) 376
PvuI CGATCG 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 212
Sau3AI GATC 6 cut(s) 25, 61, 189, 231, 330, 376
Sau96I GGNCC 2 cut(s) 34, 270
SchI GAGTC 1 cut(s) 164
SduI GDGCHC 1 cut(s) 117
SetI ASST 4 cut(s) 51, 84, 297, 386
SinI GGWCC 2 cut(s) 34, 270
SmiMI CAYNNNNRTG 1 cut(s) 212
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 1 cut(s) 323
SsiI CCGC 1 cut(s) 148
SspMI CTAG 1 cut(s) 303
TaiI ACGT 1 cut(s) 51
TaqI TCGA 4 cut(s) 24, 117, 192, 234
TasI AATT 1 cut(s) 323
TfiI GAWTC 1 cut(s) 135
TscAI CASTG 3 cut(s) 44, 145, 366
TseFI GTSAC 1 cut(s) 361
Tsp45I GTSAC 1 cut(s) 361
TspDTI ATGAA 3 cut(s) 188, 230, 316
TspRI CASTG 3 cut(s) 44, 145, 366
VpaK11BI GGWCC 2 cut(s) 34, 270
XspI CTAG 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.