Rmu_sc0000879.1_g000009

Phytohormone-binding protein-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000879.1
Physical Location & Seq
Reverse (-)
29215 .. 29502
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000879.1_g000009.1.cds

Sequence Viewer

Length: 288 bp
atgttagatgcatcaaagataatttaccagaaggacaagattgtggagcttgatgagtctgtgcataaaattgggctgcaaataataggaggccacttgaaccatgggttttcttcatacaaaacaagtttccaacttactgcaattcaagagcaggagatcctggttagtttcacagtgacctatgagtctgaagttaaagatactaccatgccatcaaggtcaacccaagccgctgtagctttcatcaggagcctagagtcctatttgttaagtgctgctgcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.54

Weight (kDa)

5.48

Isoelectric Point (pI)

45.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 187
AciI CCGC 1 cut(s) 234
AclWI GGATC 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 213
AgsI TTSAA 2 cut(s) 100, 149
AjnI CCWGG 1 cut(s) 162
AluBI AGCT 2 cut(s) 49, 242
AluI AGCT 2 cut(s) 49, 242
AlwI GGATC 1 cut(s) 154
AoxI GGCC 1 cut(s) 91
ApeKI GCWGC 3 cut(s) 76, 278, 281
BbvI GCAGC 3 cut(s) 63, 265, 268
BccI CCATC 1 cut(s) 223
BciT130I CCWGG 1 cut(s) 164
BfaI CTAG 2 cut(s) 257, 286
BfmI CTRYAG 1 cut(s) 237
BisI GCNGC 4 cut(s) 77, 234, 279, 282
BlsI GCNGC 4 cut(s) 78, 235, 280, 283
Bme1390I CCNGG 1 cut(s) 164
BmiI GGNNCC 1 cut(s) 254
BmrFI CCNGG 1 cut(s) 164
BmsI GCATC 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 103
BseBI CCWGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 103
BseXI GCAGC 3 cut(s) 63, 265, 268
BshFI GGCC 1 cut(s) 93
BsnI GGCC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 159
Bsp19I CCATGG 1 cut(s) 103
BspACI CCGC 1 cut(s) 234
BspANI GGCC 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 254
BspPI GGATC 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 103
BssMI GATC 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 164
Bst4CI ACNGT 1 cut(s) 178
BstDSI CCRYGG 1 cut(s) 103
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 162
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 3 cut(s) 63, 265, 268
BstX2I RGATCY 1 cut(s) 159
BstYI RGATCY 1 cut(s) 159
BsuRI GGCC 1 cut(s) 93
BtgI CCRYGG 1 cut(s) 103
BtsIMutI CAGTG 1 cut(s) 183
CviAII CATG 2 cut(s) 104, 211
CviJI RGCY 6 cut(s) 49, 76, 93, 233, 242, 255
CviKI_1 RGCY 6 cut(s) 49, 76, 93, 233, 242, 255
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
DrdI GACNNNNNNGTC 1 cut(s) 187
DseDI GACNNNNNNGTC 1 cut(s) 187
Eco130I CCWWGG 1 cut(s) 103
Eco57I CTGAAG 1 cut(s) 213
EcoRII CCWGG 1 cut(s) 162
EcoT14I CCWWGG 1 cut(s) 103
EcoT22I ATGCAT 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 2 cut(s) 107, 214
FaiI YATR 5 cut(s) 66, 105, 118, 186, 212
FatI CATG 2 cut(s) 103, 210
Fnu4HI GCNGC 4 cut(s) 77, 234, 279, 282
Fsp4HI GCNGC 4 cut(s) 77, 234, 279, 282
FspBI CTAG 2 cut(s) 257, 286
GluI GCNGC 4 cut(s) 77, 234, 279, 282
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 2 cut(s) 107, 214
HincII GTYRAC 1 cut(s) 225
HindII GTYRAC 1 cut(s) 225
HinfI GANTC 3 cut(s) 56, 188, 260
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 2 cut(s) 149, 250
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 1 cut(s) 25
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4V TGCA 4 cut(s) 11, 64, 79, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
Hsp92II CATG 2 cut(s) 107, 214
Kzo9I GATC 1 cut(s) 159
LmnI GCTCC 2 cut(s) 46, 252
LpnPI CCDG 5 cut(s) 41, 140, 149, 176, 235
Lsp1109I GCAGC 3 cut(s) 63, 265, 268
LweI GCATC 1 cut(s) 20
MaeI CTAG 2 cut(s) 257, 286
MaeIII GTNAC 1 cut(s) 178
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 1 cut(s) 105
MflI RGATCY 1 cut(s) 159
MluCI AATT 3 cut(s) 21, 69, 144
MlyI GAGTC 3 cut(s) 65, 197, 269
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 1 cut(s) 83
Mph1103I ATGCAT 1 cut(s) 13
MseI TTAA 2 cut(s) 198, 272
MspA1I CMGCKG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 164
MvaI CCWGG 1 cut(s) 164
MwoI GCNNNNNNNGC 1 cut(s) 239
NcoI CCATGG 1 cut(s) 103
NdeII GATC 1 cut(s) 159
NlaIII CATG 2 cut(s) 107, 214
NlaIV GGNNCC 1 cut(s) 254
NmuCI GTSAC 1 cut(s) 178
NsiI ATGCAT 1 cut(s) 13
PkrI GCNGC 4 cut(s) 78, 235, 280, 283
PleI GAGTC 3 cut(s) 64, 196, 268
PpsI GAGTC 3 cut(s) 64, 196, 268
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
PspN4I GGNNCC 1 cut(s) 254
PsuI RGATCY 1 cut(s) 159
SaqAI TTAA 2 cut(s) 198, 272
SatI GCNGC 4 cut(s) 77, 234, 279, 282
Sau3AI GATC 1 cut(s) 159
SchI GAGTC 3 cut(s) 65, 197, 269
ScrFI CCNGG 1 cut(s) 164
SetI ASST 4 cut(s) 51, 185, 224, 244
SfaNI GCATC 1 cut(s) 20
SfcI CTRYAG 1 cut(s) 237
Sse9I AATT 3 cut(s) 21, 69, 144
SsiI CCGC 1 cut(s) 234
SspMI CTAG 2 cut(s) 257, 286
StyD4I CCNGG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 178
TasI AATT 3 cut(s) 21, 69, 144
TauI GCSGC 1 cut(s) 236
Tru1I TTAA 2 cut(s) 198, 272
Tru9I TTAA 2 cut(s) 198, 272
TscAI CASTG 1 cut(s) 183
TseFI GTSAC 1 cut(s) 178
TseI GCWGC 3 cut(s) 76, 278, 281
Tsp45I GTSAC 1 cut(s) 178
TspDTI ATGAA 2 cut(s) 105, 235
TspRI CASTG 1 cut(s) 183
XcmI CCANNNNNNNNNTGG 1 cut(s) 101
XspI CTAG 2 cut(s) 257, 286
Zsp2I ATGCAT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.