Rmu_sc0001517.1_g000011

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001517.1
Physical Location & Seq
Reverse (-)
31552 .. 32424
873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001517.1_g000011.1.cds

Sequence Viewer

Length: 507 bp
atggcccgattcttcttcactcagagtctccaactccgccactccctcctccggtgccggccccggccagcccatgcccgccgggcctactcgacccgatccgggcagctcttcgagatcgagataaacccctccacctccagcccagcggaaggcgaatcggaggccctcatgctcaagaagctagacgacatcgttcagaggatcctcgtccagaaggccacccctgattggctccccttcgttcccggctcctccttctgggtcccgccccgacggtcccccctcggagtcaacgacttcgtcggaagattggctgacaagctctccgatgaggagtccctctccgtcgccaccgaccgaggctggccctgctctgattttttcatcaatggcagtgaatctgcggaaacaaaggaggttggtgaggaggcagaaggatcaggagaactagaggtggtggaggtggatgtaaaggttttgacagccaacttcgaggatgagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

168

Amino Acids

18.76

Weight (kDa)

4.83

Isoelectric Point (pI)

53.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 54
AciI CCGC 5 cut(s) 37, 79, 149, 269, 407
AclWI GGATC 4 cut(s) 93, 199, 212, 448
AcoI YGGCCR 1 cut(s) 65
AfiI CCNNNNNNNGG 5 cut(s) 51, 102, 152, 231, 261
AluBI AGCT 3 cut(s) 109, 184, 325
AluI AGCT 3 cut(s) 109, 184, 325
Alw26I GTCTC 1 cut(s) 32
AlwI GGATC 4 cut(s) 93, 199, 212, 448
AoxI GGCC 7 cut(s) 3, 59, 65, 84, 165, 219, 368
ApeKI GCWGC 1 cut(s) 106
AspS9I GGNCC 7 cut(s) 4, 60, 84, 166, 265, 279, 369
AsuC2I CCSGG 4 cut(s) 64, 83, 103, 249
AsuHPI GGTGA 1 cut(s) 437
AvaII GGWCC 2 cut(s) 265, 279
BamHI GGATCC 1 cut(s) 204
BanI GGYRCC 1 cut(s) 54
BbvI GCAGC 1 cut(s) 118
BcnI CCSGG 4 cut(s) 64, 83, 103, 249
BcoDI GTCTC 1 cut(s) 32
BfaI CTAG 2 cut(s) 185, 452
BglI GCCNNNNNGGC 1 cut(s) 83
BisI GCNGC 1 cut(s) 107
BlsI GCNGC 1 cut(s) 108
Bme1390I CCNGG 4 cut(s) 64, 83, 103, 249
Bme18I GGWCC 2 cut(s) 265, 279
BmgT120I GGNCC 7 cut(s) 4, 60, 84, 166, 265, 279, 369
BmiI GGNNCC 8 cut(s) 56, 62, 206, 236, 253, 266, 267, 281
BmrFI CCNGG 4 cut(s) 64, 83, 103, 249
BplI GAGNNNNNCTC 2 cut(s) 329, 361
BpmI CTGGAG 1 cut(s) 124
BpuEI CTTGAG 1 cut(s) 161
BpuMI CCSGG 4 cut(s) 64, 83, 103, 249
BsaJI CCNNGG 3 cut(s) 62, 286, 361
BsaWI WCCGGW 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 311, 341
Bsc4I CCNNNNNNNGG 5 cut(s) 51, 102, 152, 231, 261
Bse118I RCCGGY 1 cut(s) 57
BseDI CCNNGG 3 cut(s) 62, 286, 361
BseGI GGATG 2 cut(s) 475, 505
BseLI CCNNNNNNNGG 5 cut(s) 51, 102, 152, 231, 261
BseMII CTCAG 1 cut(s) 35
BseRI GAGGAG 4 cut(s) 38, 244, 350, 443
BseXI GCAGC 1 cut(s) 118
BseYI CCCAGC 1 cut(s) 145
Bsh1285I CGRYCG 1 cut(s) 361
BshFI GGCC 7 cut(s) 5, 61, 67, 86, 167, 221, 370
BshNI GGYRCC 1 cut(s) 54
BsiEI CGRYCG 1 cut(s) 361
BsiSI CCGG 6 cut(s) 52, 58, 64, 82, 102, 249
BslFI GGGAC 3 cut(s) 251, 265, 325
BslI CCNNNNNNNGG 5 cut(s) 51, 102, 152, 231, 261
BsmAI GTCTC 1 cut(s) 32
BsmFI GGGAC 3 cut(s) 251, 265, 325
BsnI GGCC 7 cut(s) 5, 61, 67, 86, 167, 221, 370
Bsp143I GATC 4 cut(s) 98, 117, 204, 440
BspACI CCGC 5 cut(s) 37, 79, 149, 269, 407
BspANI GGCC 7 cut(s) 5, 61, 67, 86, 167, 221, 370
BspCNI CTCAG 1 cut(s) 34
BspLI GGNNCC 8 cut(s) 56, 62, 206, 236, 253, 266, 267, 281
BspPI GGATC 4 cut(s) 93, 199, 212, 448
BspQI GCTCTTC 1 cut(s) 116
BspT107I GGYRCC 1 cut(s) 54
BsrFI RCCGGY 1 cut(s) 57
BssAI RCCGGY 1 cut(s) 57
BssECI CCNNGG 3 cut(s) 62, 286, 361
BssMI GATC 4 cut(s) 98, 117, 204, 440
Bst4CI ACNGT 1 cut(s) 279
Bst6I CTCTTC 1 cut(s) 116
BstC8I GCNNGC 4 cut(s) 59, 69, 79, 368
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 2 cut(s) 475, 505
BstKTI GATC 4 cut(s) 101, 120, 207, 443
BstMAI GTCTC 1 cut(s) 32
BstMBI GATC 4 cut(s) 98, 117, 204, 440
BstMCI CGRYCG 1 cut(s) 361
BstMWI GCNNNNNNNGC 3 cut(s) 83, 181, 372
BstSCI CCNGG 4 cut(s) 62, 81, 101, 247
BstV1I GCAGC 1 cut(s) 118
BstX2I RGATCY 1 cut(s) 204
BstYI RGATCY 1 cut(s) 204
BsuRI GGCC 7 cut(s) 5, 61, 67, 86, 167, 221, 370
BtsCI GGATG 2 cut(s) 475, 505
BtsI GCAGTG 1 cut(s) 403
BtsIMutI CAGTG 1 cut(s) 403
Cac8I GCNNGC 4 cut(s) 59, 69, 79, 368
Cfr10I RCCGGY 1 cut(s) 57
Cfr13I GGNCC 7 cut(s) 4, 60, 84, 166, 265, 279, 369
CviAII CATG 2 cut(s) 74, 172
DdeI CTNAG 1 cut(s) 21
DpnI GATC 4 cut(s) 100, 119, 206, 442
DpnII GATC 4 cut(s) 98, 117, 204, 440
EaeI YGGCCR 1 cut(s) 65
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
EciI GGCGGA 1 cut(s) 26
Eco47I GGWCC 2 cut(s) 265, 279
EcoO109I RGGNCCY 2 cut(s) 166, 265
FaeI CATG 2 cut(s) 77, 175
FaiI YATR 2 cut(s) 75, 173
FaqI GGGAC 3 cut(s) 251, 265, 325
FatI CATG 2 cut(s) 73, 171
FauI CCCGC 2 cut(s) 86, 276
Fnu4HI GCNGC 1 cut(s) 107
FokI GGATG 1 cut(s) 482
Fsp4HI GCNGC 1 cut(s) 107
FspBI CTAG 2 cut(s) 185, 452
GluI GCNGC 1 cut(s) 107
GsaI CCCAGC 1 cut(s) 149
GsuI CTGGAG 1 cut(s) 124
HaeIII GGCC 7 cut(s) 5, 61, 67, 86, 167, 221, 370
HapII CCGG 6 cut(s) 52, 58, 64, 82, 102, 249
Hin1II CATG 2 cut(s) 77, 175
HincII GTYRAC 1 cut(s) 295
HindII GTYRAC 1 cut(s) 295
HinfI GANTC 6 cut(s) 9, 25, 158, 291, 338, 401
HpaII CCGG 6 cut(s) 52, 58, 64, 82, 102, 249
HphI GGTGA 1 cut(s) 437
Hpy166II GTNNAC 1 cut(s) 295
Hpy188I TCNGA 7 cut(s) 24, 163, 201, 290, 308, 331, 379
Hpy188III TCNNGA 5 cut(s) 115, 121, 178, 214, 444
Hpy8I GTNNAC 1 cut(s) 295
Hpy99I CGWCG 3 cut(s) 279, 308, 353
HpyAV CCTTC 5 cut(s) 146, 211, 250, 268, 431
HpyCH4III ACNGT 1 cut(s) 279
HpyF10VI GCNNNNNNNGC 3 cut(s) 83, 181, 372
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 2 cut(s) 77, 175
KflI GGGWCCC 1 cut(s) 265
KroI GCCGGC 1 cut(s) 57
KroNI GCCGGC 1 cut(s) 59
Kzo9I GATC 4 cut(s) 98, 117, 204, 440
LguI GCTCTTC 1 cut(s) 116
LmnI GCTCC 2 cut(s) 240, 257
Lsp1109I GCAGC 1 cut(s) 118
MaeI CTAG 2 cut(s) 185, 452
MalI GATC 4 cut(s) 100, 119, 206, 442
MboI GATC 4 cut(s) 98, 117, 204, 440
MboII GAAGA 4 cut(s) 4, 7, 103, 321
MflI RGATCY 1 cut(s) 204
MlyI GAGTC 3 cut(s) 34, 300, 347
MmeI TCCRAC 2 cut(s) 55, 286
MroNI GCCGGC 1 cut(s) 57
MspA1I CMGCKG 1 cut(s) 149
MspI CCGG 6 cut(s) 52, 58, 64, 82, 102, 249
MspR9I CCNGG 4 cut(s) 64, 83, 103, 249
MwoI GCNNNNNNNGC 3 cut(s) 83, 181, 372
NaeI GCCGGC 1 cut(s) 59
NciI CCSGG 4 cut(s) 64, 83, 103, 249
NdeII GATC 4 cut(s) 98, 117, 204, 440
NgoMIV GCCGGC 1 cut(s) 57
NlaIII CATG 2 cut(s) 77, 175
NlaIV GGNNCC 8 cut(s) 56, 62, 206, 236, 253, 266, 267, 281
PciSI GCTCTTC 1 cut(s) 116
PcsI WCGNNNNNNNCGW 1 cut(s) 294
PdiI GCCGGC 1 cut(s) 59
PfeI GAWTC 3 cut(s) 9, 158, 401
PflFI GACNNNGTC 1 cut(s) 302
PkrI GCNGC 1 cut(s) 108
PleI GAGTC 3 cut(s) 33, 299, 346
PpsI GAGTC 3 cut(s) 33, 299, 346
PpuMI RGGWCCY 1 cut(s) 265
Psp5II RGGWCCY 1 cut(s) 265
PspFI CCCAGC 1 cut(s) 145
PspN4I GGNNCC 8 cut(s) 56, 62, 206, 236, 253, 266, 267, 281
PspPI GGNCC 7 cut(s) 4, 60, 84, 166, 265, 279, 369
PspPPI RGGWCCY 1 cut(s) 265
PsuI RGATCY 1 cut(s) 204
PsyI GACNNNGTC 1 cut(s) 302
SapI GCTCTTC 1 cut(s) 116
SatI GCNGC 1 cut(s) 107
Sau3AI GATC 4 cut(s) 98, 117, 204, 440
Sau96I GGNCC 7 cut(s) 4, 60, 84, 166, 265, 279, 369
SchI GAGTC 3 cut(s) 34, 300, 347
ScrFI CCNGG 4 cut(s) 64, 83, 103, 249
SetI ASST 8 cut(s) 111, 140, 186, 327, 423, 459, 468, 480
SinI GGWCC 2 cut(s) 265, 279
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
SsiI CCGC 5 cut(s) 37, 79, 149, 269, 407
SspMI CTAG 2 cut(s) 185, 452
StyD4I CCNGG 4 cut(s) 62, 81, 101, 247
TaaI ACNGT 1 cut(s) 279
TaqI TCGA 4 cut(s) 92, 114, 120, 495
TaqII GACCGA 1 cut(s) 375
TfiI GAWTC 3 cut(s) 9, 158, 401
TscAI CASTG 1 cut(s) 403
TseI GCWGC 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 376
TspGWI ACGGA 1 cut(s) 337
TspRI CASTG 1 cut(s) 403
Tth111I GACNNNGTC 1 cut(s) 302
VpaK11BI GGWCC 2 cut(s) 265, 279
XspI CTAG 2 cut(s) 185, 452
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.