Rmu_sc0003064.1_g000010

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003064.1
Physical Location & Seq
Reverse (-)
44002 .. 44529
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003064.1_g000010.1.cds

Sequence Viewer

Length: 528 bp
atgatggcacaagatgagaggcttagagccacttctgagatcctaaacagtatgaagatcattaagttacaatcctgggaagagaaattcaaaaactcggtcaattcccttcgagaaagagaattcaaatggttgtctgagggacaatctaggaaggcttatggaactttactctactggatgtcaccaaccattatctcttctgttgtttttctagggtgtatccttttcaaaagtgtccctctgaatgcaagtactatattcacagttttagcttcactaaggagcatgggagaacctgtgagaatgataccagaggctctttcagtaatgatccaagtcaaggtctcatttgatcggctaaatgcttttttgcttgatgatgagttgaaagatgatgagataaggaagctcccatcaccaaattcagatgagagcttgagaatacaaaaaggcattttcagttggtatcctgaatcagcaattcaaactctgaaagaagtgaacctagaagcaaaatgtgagtag

Protein Analysis

175

Amino Acids

20.1

Weight (kDa)

6.42

Isoelectric Point (pI)

46.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 34, 328
AcsI RAATTY 3 cut(s) 86, 122, 424
AfaI GTAC 1 cut(s) 256
AfiI CCNNNNNNNGG 1 cut(s) 343
AgsI TTSAA 5 cut(s) 91, 127, 232, 391, 488
AjnI CCWGG 1 cut(s) 74
AluBI AGCT 3 cut(s) 275, 412, 438
AluI AGCT 3 cut(s) 275, 412, 438
Alw26I GTCTC 1 cut(s) 352
AlwI GGATC 2 cut(s) 34, 328
ApoI RAATTY 3 cut(s) 86, 122, 424
ArsI GACNNNNNNTTYG 2 cut(s) 84, 116
AsuHPI GGTGA 2 cut(s) 177, 411
BccI CCATC 1 cut(s) 424
BciT130I CCWGG 1 cut(s) 76
BciVI GTATCC 2 cut(s) 233, 480
BcoDI GTCTC 1 cut(s) 352
BfaI CTAG 3 cut(s) 150, 215, 509
BfuI GTATCC 2 cut(s) 233, 480
BmcAI AGTACT 1 cut(s) 256
Bme1390I CCNGG 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 76
BpuEI CTTGAG 1 cut(s) 460
BsaI GGTCTC 1 cut(s) 352
BsaJI CCNNGG 1 cut(s) 75
BsaXI ACNNNNNCTCC 2 cut(s) 285, 315
Bsc4I CCNNNNNNNGG 1 cut(s) 343
Bse1I ACTGG 1 cut(s) 182
BseBI CCWGG 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 75
BseGI GGATG 1 cut(s) 186
BseLI CCNNNNNNNGG 1 cut(s) 343
BseMII CTCAG 2 cut(s) 27, 129
BseNI ACTGG 1 cut(s) 182
BslFI GGGAC 2 cut(s) 156, 224
BslI CCNNNNNNNGG 1 cut(s) 343
BsmAI GTCTC 1 cut(s) 352
BsmFI GGGAC 2 cut(s) 156, 224
BsmI GAATGC 1 cut(s) 253
Bso31I GGTCTC 1 cut(s) 352
Bsp143I GATC 4 cut(s) 39, 57, 333, 355
BspCNI CTCAG 2 cut(s) 28, 130
BspPI GGATC 2 cut(s) 34, 328
BspTNI GGTCTC 1 cut(s) 352
BsrI ACTGG 1 cut(s) 182
BssECI CCNNGG 1 cut(s) 75
BssMI GATC 4 cut(s) 39, 57, 333, 355
Bst2UI CCWGG 1 cut(s) 76
Bst4CI ACNGT 2 cut(s) 50, 268
Bst6I CTCTTC 2 cut(s) 75, 205
BstDEI CTNAG 4 cut(s) 23, 36, 138, 281
BstF5I GGATG 1 cut(s) 186
BstKTI GATC 4 cut(s) 42, 60, 336, 358
BstMAI GTCTC 1 cut(s) 352
BstMBI GATC 4 cut(s) 39, 57, 333, 355
BstNI CCWGG 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 74
BstX2I RGATCY 1 cut(s) 39
BstYI RGATCY 1 cut(s) 39
BsuI GTATCC 2 cut(s) 233, 480
BtsCI GGATG 1 cut(s) 186
Csp6I GTAC 1 cut(s) 255
CviAII CATG 1 cut(s) 289
CviJI RGCY 8 cut(s) 22, 29, 158, 275, 320, 361, 412, 438
CviKI_1 RGCY 8 cut(s) 22, 29, 158, 275, 320, 361, 412, 438
CviQI GTAC 1 cut(s) 255
DdeI CTNAG 4 cut(s) 23, 36, 138, 281
DpnI GATC 4 cut(s) 41, 59, 335, 357
DpnII GATC 4 cut(s) 39, 57, 333, 355
Eam1104I CTCTTC 2 cut(s) 75, 205
EarI CTCTTC 2 cut(s) 75, 205
Eco31I GGTCTC 1 cut(s) 352
EcoRI GAATTC 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 74
FaeI CATG 1 cut(s) 292
FaiI YATR 4 cut(s) 53, 162, 260, 290
FaqI GGGAC 2 cut(s) 156, 224
FatI CATG 1 cut(s) 288
FokI GGATG 1 cut(s) 193
FspBI CTAG 3 cut(s) 150, 215, 509
Hin1II CATG 1 cut(s) 292
HinfI GANTC 1 cut(s) 476
HphI GGTGA 2 cut(s) 177, 411
Hpy166II GTNNAC 1 cut(s) 505
Hpy188I TCNGA 5 cut(s) 37, 139, 246, 430, 495
Hpy188III TCNNGA 2 cut(s) 113, 473
Hpy8I GTNNAC 1 cut(s) 505
HpyAV CCTTC 2 cut(s) 119, 148
HpyCH4III ACNGT 2 cut(s) 50, 268
HpyCH4V TGCA 1 cut(s) 251
HpyF3I CTNAG 4 cut(s) 23, 36, 138, 281
Hsp92II CATG 1 cut(s) 292
Kzo9I GATC 4 cut(s) 39, 57, 333, 355
LmnI GCTCC 2 cut(s) 285, 417
LpnPI CCDG 6 cut(s) 61, 88, 163, 312, 327, 486
MaeI CTAG 3 cut(s) 150, 215, 509
MaeIII GTNAC 2 cut(s) 66, 183
MalI GATC 4 cut(s) 41, 59, 335, 357
MboI GATC 4 cut(s) 39, 57, 333, 355
MboII GAAGA 3 cut(s) 67, 92, 192
MflI RGATCY 1 cut(s) 39
MluCI AATT 5 cut(s) 86, 103, 122, 424, 483
MnlI CCTC 4 cut(s) 12, 133, 252, 310
MseI TTAA 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 76
Mva1269I GAATGC 1 cut(s) 253
MvaI CCWGG 1 cut(s) 76
NdeII GATC 4 cut(s) 39, 57, 333, 355
NlaIII CATG 1 cut(s) 292
NmuCI GTSAC 1 cut(s) 183
PctI GAATGC 1 cut(s) 253
PfeI GAWTC 1 cut(s) 476
Psp6I CCWGG 1 cut(s) 74
PspGI CCWGG 1 cut(s) 74
PsuI RGATCY 1 cut(s) 39
RsaI GTAC 1 cut(s) 256
RsaNI GTAC 1 cut(s) 255
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 4 cut(s) 39, 57, 333, 355
ScaI AGTACT 1 cut(s) 256
ScrFI CCNGG 1 cut(s) 76
SetI ASST 6 cut(s) 277, 301, 348, 414, 440, 510
SmlI CTYRAG 1 cut(s) 439
SmoI CTYRAG 1 cut(s) 439
Sse9I AATT 5 cut(s) 86, 103, 122, 424, 483
SspMI CTAG 3 cut(s) 150, 215, 509
StyD4I CCNGG 1 cut(s) 74
TaaI ACNGT 2 cut(s) 50, 268
TaqI TCGA 1 cut(s) 112
TaqII GACCGA 1 cut(s) 88
TasI AATT 5 cut(s) 86, 103, 122, 424, 483
TatI WGTACW 1 cut(s) 254
TfiI GAWTC 1 cut(s) 476
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TseFI GTSAC 1 cut(s) 183
Tsp45I GTSAC 1 cut(s) 183
TspDTI ATGAA 1 cut(s) 68
XapI RAATTY 3 cut(s) 86, 122, 424
XspI CTAG 3 cut(s) 150, 215, 509
ZrmI AGTACT 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.