Rh7AG329600

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
37801102 .. 37801333
232 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG329600.1

Sequence Viewer

Length: 232 bp
ATGGGAGAACCTGTGAGAATGATACCAGAGGCTCTTTCAGTAATGATCCAAGTCAAGGTCTCATTTGATCGGCTAAATGCTTTTTTGCTTGATGATGAGTTGGAAGATGATGAGATAAGGAAGCTCCCATCACCAAATTCAGATGAGAGCTTGAGAATACAAAAAGGCATTTTCGGTTGGTATCCTGAATCAGCAATTCAAACTCTGAAAGAAGTGAACCTAGAAGCAAAAT

Protein Analysis

77

Amino Acids

8.8

Weight (kDa)

4.49

Isoelectric Point (pI)

38.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 40
AcsI RAATTY 1 cut(s) 136
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 200
AluBI AGCT 2 cut(s) 124, 150
AluI AGCT 2 cut(s) 124, 150
Alw26I GTCTC 1 cut(s) 64
AlwI GGATC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 123
BccI CCATC 1 cut(s) 136
BciVI GTATCC 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 64
BfaI CTAG 1 cut(s) 221
BfuI GTATCC 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 172
BsaI GGTCTC 1 cut(s) 64
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 64
Bso31I GGTCTC 1 cut(s) 64
Bsp143I GATC 2 cut(s) 45, 67
BspPI GGATC 1 cut(s) 40
BspTNI GGTCTC 1 cut(s) 64
BssMI GATC 2 cut(s) 45, 67
BstKTI GATC 2 cut(s) 48, 70
BstMAI GTCTC 1 cut(s) 64
BstMBI GATC 2 cut(s) 45, 67
BsuI GTATCC 1 cut(s) 192
CviJI RGCY 4 cut(s) 32, 73, 124, 150
CviKI_1 RGCY 4 cut(s) 32, 73, 124, 150
DpnI GATC 2 cut(s) 47, 69
DpnII GATC 2 cut(s) 45, 67
Eco31I GGTCTC 1 cut(s) 64
FspBI CTAG 1 cut(s) 221
HinfI GANTC 1 cut(s) 188
HphI GGTGA 1 cut(s) 123
Hpy166II GTNNAC 1 cut(s) 217
Hpy188I TCNGA 2 cut(s) 142, 207
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 1 cut(s) 217
Kzo9I GATC 2 cut(s) 45, 67
LmnI GCTCC 1 cut(s) 129
LpnPI CCDG 3 cut(s) 24, 39, 198
MaeI CTAG 1 cut(s) 221
MalI GATC 2 cut(s) 47, 69
MboI GATC 2 cut(s) 45, 67
MboII GAAGA 1 cut(s) 116
MluCI AATT 2 cut(s) 136, 195
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 1 cut(s) 22
NdeII GATC 2 cut(s) 45, 67
PfeI GAWTC 1 cut(s) 188
Sau3AI GATC 2 cut(s) 45, 67
SetI ASST 5 cut(s) 13, 60, 126, 152, 222
SgeI CNNG 7 cut(s) 23, 38, 62, 67, 101, 163, 197
SmlI CTYRAG 1 cut(s) 151
SmoI CTYRAG 1 cut(s) 151
Sse9I AATT 2 cut(s) 136, 195
SspMI CTAG 1 cut(s) 221
TasI AATT 2 cut(s) 136, 195
TfiI GAWTC 1 cut(s) 188
XapI RAATTY 1 cut(s) 136
XspI CTAG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.