Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003181.1

Orthogroup ID

OG0003157

Physical Location & Seq

Genomic Coordinates Reverse (-)

68116 .. 69277

Gene Structure 1162 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003181.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

atgagctccaacacgactgacaccaagaaggagaagaagggtcctcctcaaattgttaaattgaataaagctttggcattggctgaaaaatgggttagtaacatgagtaaattaccagcacaagatgagtcttttgagacacagagtcgacctgctaggcttggactaggtgctaaagttccccgtgcatccacatttgtgccttcagatgatccccttgaaagaaagctatattacaagttgaatgctcaaaagagaaaagctgccaaaattgcagaggagttggcaccagctgctgctgatggtgatgatgaagataatgaagacagcagaaccagtgcgttcgagaagaaaaagagagcagctaatccactcaccccacctttagggaaaagaaaaggagaaagtgatctcaccatgagacactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3245

Protein Analysis

142

Amino Acids

15.66

Weight (kDa)

9.6

Isoelectric Point (pI)

49.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003157)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G61370 AT3G61370 AT3G61370 AT4G07940
fragaria_vesca	FvH4_7g14280 FvH4_7g14280 FvH4_7g14280
malus_domestica	MD01G1060700.v1.1 MD07G1137000.v1.1
prunus_persica	Prupe.1G174800_v2.0.a1 Prupe.1G174800_v2.0.a1 Prupe.2G170600_v2.0.a1 Prupe.2G170600_v2.0.a1 Prupe.2G170600_v2.0.a1
pyrus_communis	pycom01g09090
rosa_chinensis	RchiOBHm_Chr1g0355271
rosa_laevigata	RLG00000028165 RLG00000034646
rosa_multiflora	Rmu_sc0003115.1_g000045 Rmu_sc0003181.1_g000023 Rmu_sc0004135.1_g000023 Rmu_sc0008923.1_g000004 Rmu_sc0027409.1_g000003
rosa_roxburghii	Rroxscaffold_1G00031710 Rroxscaffold_4G00300540
rosa_rugosa	Rorug01G0246300
rosa_samantha	Rh1AG258400 Rh1BG228000 Rh1CG242100 Rh1DG255800 Rh5AG327200 Rh5BG338300 Rh5CG362700 Rh5DG350400
rosa_wichuraiana	Rw0G018420 Rw1G022810 Rw5G030900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	160
AccB1I	GGYRCC	1 cut(s)	286
AccI	GTMKAC	1 cut(s)	148
AclWI	GGATC	1 cut(s)	206
AcuI	CTGAAG	1 cut(s)	189
AfiI	CCNNNNNNNGG	1 cut(s)	386
AgsI	TTSAA	3 cut(s)	64, 221, 244
AhdI	GACNNNNNGTC	1 cut(s)	144
AjuI	GAANNNNNNNTTGG	2 cut(s)	56, 88
AleI	CACNNNNGTG	1 cut(s)	197
AluBI	AGCT	6 cut(s)	6, 71, 229, 263, 293, 365
AluI	AGCT	6 cut(s)	6, 71, 229, 263, 293, 365
Alw21I	GWGCWC	1 cut(s)	8
Alw26I	GTCTC	2 cut(s)	131, 415
AlwI	GGATC	1 cut(s)	206
AlwNI	CAGNNNCTG	1 cut(s)	296
ApeKI	GCWGC	4 cut(s)	263, 293, 296, 362
AspS9I	GGNCC	1 cut(s)	41
AsuHPI	GGTGA	3 cut(s)	317, 367, 406
AvaII	GGWCC	1 cut(s)	41
BanI	GGYRCC	1 cut(s)	286
BanII	GRGCYC	1 cut(s)	8
BbsI	GAAGAC	1 cut(s)	330
Bbv12I	GWGCWC	1 cut(s)	8
BbvI	GCAGC	4 cut(s)	250, 280, 283, 374
BccI	CCATC	1 cut(s)	296
BcoDI	GTCTC	2 cut(s)	131, 415
BfaI	CTAG	3 cut(s)	156, 167, 427
BfuAI	ACCTGC	1 cut(s)	160
BisI	GCNGC	4 cut(s)	264, 294, 297, 363
BlsI	GCNGC	4 cut(s)	265, 295, 298, 364
Bme18I	GGWCC	1 cut(s)	41
BmeRI	GACNNNNNGTC	1 cut(s)	144
BmgT120I	GGNCC	1 cut(s)	41
BmiI	GGNNCC	2 cut(s)	42, 288
BmsI	GCATC	1 cut(s)	197
BpiI	GAAGAC	1 cut(s)	330
Bsc4I	CCNNNNNNNGG	1 cut(s)	386
Bse1I	ACTGG	1 cut(s)	336
BseGI	GGATG	1 cut(s)	188
BseLI	CCNNNNNNNGG	1 cut(s)	386
BseNI	ACTGG	1 cut(s)	336
BseRI	GAGGAG	2 cut(s)	36, 293
BseXI	GCAGC	4 cut(s)	250, 280, 283, 374
BshNI	GGYRCC	1 cut(s)	286
BsiHKAI	GWGCWC	1 cut(s)	8
BslI	CCNNNNNNNGG	1 cut(s)	386
BsmAI	GTCTC	2 cut(s)	131, 415
BsmI	GAATGC	1 cut(s)	250
Bsp1286I	GDGCHC	1 cut(s)	8
Bsp143I	GATC	2 cut(s)	211, 409
BspLI	GGNNCC	2 cut(s)	42, 288
BspMI	ACCTGC	1 cut(s)	160
BspPI	GGATC	1 cut(s)	206
BspT107I	GGYRCC	1 cut(s)	286
BsrI	ACTGG	1 cut(s)	336
BssMI	GATC	2 cut(s)	211, 409
BstAPI	GCANNNNNTGC	1 cut(s)	293
BstF5I	GGATG	1 cut(s)	188
BstKTI	GATC	2 cut(s)	214, 412
BstMAI	GTCTC	2 cut(s)	131, 415
BstMBI	GATC	2 cut(s)	211, 409
BstMWI	GCNNNNNNNGC	2 cut(s)	272, 293
BstV1I	GCAGC	4 cut(s)	250, 280, 283, 374
BstV2I	GAAGAC	1 cut(s)	330
BtsCI	GGATG	1 cut(s)	188
BtsIMutI	CAGTG	1 cut(s)	343
BveI	ACCTGC	1 cut(s)	160
CaiI	CAGNNNCTG	1 cut(s)	296
Cfr13I	GGNCC	1 cut(s)	41
CviAII	CATG	2 cut(s)	103, 418
CviJI	RGCY	8 cut(s)	6, 71, 83, 160, 229, 263, 293, 365
CviKI_1	RGCY	8 cut(s)	6, 71, 83, 160, 229, 263, 293, 365
DpnI	GATC	2 cut(s)	213, 411
DpnII	GATC	2 cut(s)	211, 409
DriI	GACNNNNNGTC	1 cut(s)	144
Eam1105I	GACNNNNNGTC	1 cut(s)	144
Ecl136II	GAGCTC	1 cut(s)	6
Eco24I	GRGCYC	1 cut(s)	8
Eco47I	GGWCC	1 cut(s)	41
Eco53kI	GAGCTC	1 cut(s)	6
Eco57I	CTGAAG	1 cut(s)	189
EcoICRI	GAGCTC	1 cut(s)	6
EcoO109I	RGGNCCY	1 cut(s)	41
EcoT38I	GRGCYC	1 cut(s)	8
FaeI	CATG	2 cut(s)	106, 421
FaiI	YATR	3 cut(s)	104, 232, 419
FatI	CATG	2 cut(s)	102, 417
FblI	GTMKAC	1 cut(s)	148
Fnu4HI	GCNGC	4 cut(s)	264, 294, 297, 363
FokI	GGATG	1 cut(s)	175
FriOI	GRGCYC	1 cut(s)	8
Fsp4HI	GCNGC	4 cut(s)	264, 294, 297, 363
FspBI	CTAG	3 cut(s)	156, 167, 427
GluI	GCNGC	4 cut(s)	264, 294, 297, 363
Hin1II	CATG	2 cut(s)	106, 421
HincII	GTYRAC	1 cut(s)	149
HindII	GTYRAC	1 cut(s)	149
HindIII	AAGCTT	1 cut(s)	69
HinfI	GANTC	2 cut(s)	128, 145
HphI	GGTGA	3 cut(s)	317, 367, 406
Hpy166II	GTNNAC	1 cut(s)	149
Hpy188I	TCNGA	1 cut(s)	208
Hpy188III	TCNNGA	1 cut(s)	346
Hpy8I	GTNNAC	1 cut(s)	149
HpyAV	CCTTC	3 cut(s)	22, 31, 213
HpyCH4V	TGCA	2 cut(s)	188, 275
HpyF10VI	GCNNNNNNNGC	2 cut(s)	272, 293
Hsp92II	CATG	2 cut(s)	106, 421
Kzo9I	GATC	2 cut(s)	211, 409
LmnI	GCTCC	1 cut(s)	11
LpnPI	CCDG	4 cut(s)	129, 165, 303, 349
Lsp1109I	GCAGC	4 cut(s)	250, 280, 283, 374
LweI	GCATC	1 cut(s)	197
MaeI	CTAG	3 cut(s)	156, 167, 427
MaeIII	GTNAC	1 cut(s)	98
MalI	GATC	2 cut(s)	213, 411
MboI	GATC	2 cut(s)	211, 409
MboII	GAAGA	4 cut(s)	46, 326, 335, 361
MhlI	GDGCHC	1 cut(s)	8
MluCI	AATT	4 cut(s)	51, 59, 110, 270
MlyI	GAGTC	2 cut(s)	137, 154
MmeI	TCCRAC	1 cut(s)	33
MnlI	CCTC	3 cut(s)	54, 57, 271
MseI	TTAA	1 cut(s)	57
MslI	CAYNNNNRTG	1 cut(s)	197
MspA1I	CMGCKG	1 cut(s)	293
Mva1269I	GAATGC	1 cut(s)	250
MwoI	GCNNNNNNNGC	2 cut(s)	272, 293
NdeII	GATC	2 cut(s)	211, 409
NlaIII	CATG	2 cut(s)	106, 421
NlaIV	GGNNCC	2 cut(s)	42, 288
OliI	CACNNNNGTG	1 cut(s)	197
PctI	GAATGC	1 cut(s)	250
PkrI	GCNGC	4 cut(s)	265, 295, 298, 364
PleI	GAGTC	2 cut(s)	136, 153
PpsI	GAGTC	2 cut(s)	136, 153
PpuMI	RGGWCCY	1 cut(s)	41
Psp124BI	GAGCTC	1 cut(s)	8
Psp5II	RGGWCCY	1 cut(s)	41
PspN4I	GGNNCC	2 cut(s)	42, 288
PspPI	GGNCC	1 cut(s)	41
PspPPI	RGGWCCY	1 cut(s)	41
PstNI	CAGNNNCTG	1 cut(s)	296
PvuII	CAGCTG	1 cut(s)	293
RseI	CAYNNNNRTG	1 cut(s)	197
SacI	GAGCTC	1 cut(s)	8
SalI	GTCGAC	1 cut(s)	147
SaqAI	TTAA	1 cut(s)	57
SatI	GCNGC	4 cut(s)	264, 294, 297, 363
Sau3AI	GATC	2 cut(s)	211, 409
Sau96I	GGNCC	1 cut(s)	41
SchI	GAGTC	2 cut(s)	137, 154
SduI	GDGCHC	1 cut(s)	8
SetI	ASST	9 cut(s)	8, 73, 154, 172, 231, 265, 295, 367, 385
SfaNI	GCATC	1 cut(s)	197
SinI	GGWCC	1 cut(s)	41
SmiMI	CAYNNNNRTG	1 cut(s)	197
Sse9I	AATT	4 cut(s)	51, 59, 110, 270
SspMI	CTAG	3 cut(s)	156, 167, 427
SstI	GAGCTC	1 cut(s)	8
TaqI	TCGA	2 cut(s)	148, 345
TasI	AATT	4 cut(s)	51, 59, 110, 270
Tru1I	TTAA	1 cut(s)	57
Tru9I	TTAA	1 cut(s)	57
TscAI	CASTG	1 cut(s)	343
TseI	GCWGC	4 cut(s)	263, 293, 296, 362
TspDTI	ATGAA	2 cut(s)	327, 336
TspRI	CASTG	1 cut(s)	343
VpaK11BI	GGWCC	1 cut(s)	41
XmiI	GTMKAC	1 cut(s)	148
XspI	CTAG	3 cut(s)	156, 167, 427

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.