Rh5CG362700

Protein of unknown function (DUF3245)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
43541731 .. 43542866
1136 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG362700.1

Sequence Viewer

Length: 161 bp
ATGAACTCCAACACGACTGACACCAAGAAGGAGAAGAAGGGTCCTCCTCAAATTGTTAAATTGAATAAAGCTTTGGCATTGGCTGAAAAATGGGTTAGTAACATGAGTAAATTACCAGCAGAAGATGAGTCTTTTGAGACACAGAGTCAACCTGCTAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.85

Weight (kDa)

8.04

Isoelectric Point (pI)

49.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 64
AhdI GACNNNNNGTC 1 cut(s) 144
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw26I GTCTC 1 cut(s) 131
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 41
BmeRI GACNNNNNGTC 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 42
BseRI GAGGAG 1 cut(s) 36
BsmAI GTCTC 1 cut(s) 131
BspLI GGNNCC 1 cut(s) 42
BstMAI GTCTC 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 41
CviAII CATG 1 cut(s) 103
CviJI RGCY 2 cut(s) 71, 83
CviKI_1 RGCY 2 cut(s) 71, 83
DriI GACNNNNNGTC 1 cut(s) 144
Eam1105I GACNNNNNGTC 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 41
EcoO109I RGGNCCY 1 cut(s) 41
FaeI CATG 1 cut(s) 106
FaiI YATR 1 cut(s) 104
FatI CATG 1 cut(s) 102
FspBI CTAG 1 cut(s) 156
Hin1II CATG 1 cut(s) 106
HincII GTYRAC 1 cut(s) 149
HindII GTYRAC 1 cut(s) 149
HindIII AAGCTT 1 cut(s) 69
HinfI GANTC 2 cut(s) 128, 145
Hpy166II GTNNAC 1 cut(s) 149
Hpy8I GTNNAC 1 cut(s) 149
HpyAV CCTTC 2 cut(s) 22, 31
Hsp92II CATG 1 cut(s) 106
LpnPI CCDG 1 cut(s) 129
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 98
MboII GAAGA 2 cut(s) 46, 134
MluCI AATT 3 cut(s) 51, 59, 110
MlyI GAGTC 2 cut(s) 137, 154
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 2 cut(s) 54, 57
MseI TTAA 1 cut(s) 57
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 1 cut(s) 42
PleI GAGTC 2 cut(s) 136, 153
PpsI GAGTC 2 cut(s) 136, 153
PpuMI RGGWCCY 1 cut(s) 41
Psp5II RGGWCCY 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 42
PspPI GGNCC 1 cut(s) 41
PspPPI RGGWCCY 1 cut(s) 41
SaqAI TTAA 1 cut(s) 57
Sau96I GGNCC 1 cut(s) 41
SchI GAGTC 2 cut(s) 137, 154
SetI ASST 2 cut(s) 73, 154
SgeI CNNG 4 cut(s) 25, 37, 115, 128
SinI GGWCC 1 cut(s) 41
Sse9I AATT 3 cut(s) 51, 59, 110
SspMI CTAG 1 cut(s) 156
TasI AATT 3 cut(s) 51, 59, 110
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 41
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.