Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003262.1

Orthogroup ID

OG0008176

Physical Location & Seq

Genomic Coordinates Reverse (-)

3408 .. 4213

Gene Structure 806 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003262.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 546 bp

atgcaagatcatcacctcgcttggaggattctgcatctacaaatgtttctgccaacaaagcaaccacatctgccaaatttcatccagaaacgacatcttcagaaaccagaagcagtcgaatggaaatgcatgtatttccgggggacttcctccccatctaattctagtgttggtagcgatcatcaggaagacgttttgaaagaggatgatcatattgattactttgcagattctggttcagacgatgataattacaaggggcaagaatcaagtttgacaggttctacagtcccttcggaaccaaatgacttcgtgcctgttacttttgatgcttcagatggcccaagttcagacagtgaggaggagttggacacgtctatgcttgtcctgagcaaagattctaaattttctcatgagaagactgttcaatccataaattcgggaaaaagccagagtgcaagccacaggtcattagcatcttcatcctctgatgaggtacatcccgagagaacccagggaattgaatatagtgttattctcccataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04144 map04144

Pfam Domains

Protein Families

Ist1

Protein Analysis

181

Amino Acids

20.22

Weight (kDa)

4.88

Isoelectric Point (pI)

67.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008176)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0092741 RchiOBHm_Chr2g0092811 RchiOBHm_Chr6g0257341
rosa_multiflora	Rmu_co8093496.1_g000001 Rmu_sc0000915.1_g000001 Rmu_sc0001132.1_g000006 Rmu_sc0003262.1_g000004 Rmu_sc0003262.1_g000005 Rmu_sc0003262.1_g000006 Rmu_sc0004928.1_g000018 Rmu_sc0007564.1_g000001 Rmu_sc0013137.1_g000003 Rmu_sc0022170.1_g000001 Rmu_sc0037615.1_g000001
rosa_roxburghii	Rroxscaffold_2G00148880 Rroxscaffold_2G00148890
rosa_rugosa	Rorug02G0029200
rosa_samantha	Rh2AG074800 Rh2AG075000 Rh2AG075100 Rh2CG077800 Rh5CG321400 Rh5DG249300
rosa_wichuraiana	Rw2G005800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	76, 404, 436
AcuI	CTGAAG	2 cut(s)	83, 318
AfaI	GTAC	1 cut(s)	498
AflIII	ACRYGT	1 cut(s)	372
AgsI	TTSAA	3 cut(s)	199, 428, 524
AjiI	CACGTC	1 cut(s)	375
AjnI	CCWGG	1 cut(s)	513
AlwNI	CAGNNNCTG	1 cut(s)	233
Ama87I	CYCGRG	1 cut(s)	503
AoxI	GGCC	1 cut(s)	340
ApoI	RAATTY	3 cut(s)	76, 404, 436
AspS9I	GGNCC	1 cut(s)	341
AsuC2I	CCSGG	1 cut(s)	140
AsuHPI	GGTGA	1 cut(s)	5
AvaI	CYCGRG	1 cut(s)	503
BbsI	GAAGAC	2 cut(s)	195, 425
BccI	CCATC	2 cut(s)	163, 332
BciT130I	CCWGG	1 cut(s)	515
BclI	TGATCA	1 cut(s)	208
BcnI	CCSGG	1 cut(s)	140
BfaI	CTAG	1 cut(s)	165
BfmI	CTRYAG	1 cut(s)	285
Bme1390I	CCNGG	2 cut(s)	140, 515
BmeT110I	CYCGRG	1 cut(s)	503
BmgBI	CACGTC	1 cut(s)	375
BmgT120I	GGNCC	1 cut(s)	341
BmiI	GGNNCC	1 cut(s)	300
BmrFI	CCNGG	2 cut(s)	140, 515
BmsI	GCATC	3 cut(s)	43, 319, 485
BpiI	GAAGAC	2 cut(s)	195, 425
Bpu10I	CCTNAGC	1 cut(s)	389
BpuMI	CCSGG	1 cut(s)	140
BsaJI	CCNNGG	3 cut(s)	139, 513, 514
BseBI	CCWGG	1 cut(s)	515
BseDI	CCNNGG	3 cut(s)	139, 513, 514
BseGI	GGATG	4 cut(s)	81, 211, 482, 499
BseMII	CTCAG	1 cut(s)	380
BseRI	GAGGAG	2 cut(s)	374, 377
BshFI	GGCC	1 cut(s)	342
BsiHKCI	CYCGRG	1 cut(s)	503
BsiSI	CCGG	1 cut(s)	139
BslFI	GGGAC	2 cut(s)	157, 275
BsmFI	GGGAC	2 cut(s)	157, 275
BsnI	GGCC	1 cut(s)	342
BsoBI	CYCGRG	1 cut(s)	503
Bsp143I	GATC	3 cut(s)	7, 178, 208
BspANI	GGCC	1 cut(s)	342
BspCNI	CTCAG	1 cut(s)	381
BspHI	TCATGA	1 cut(s)	412
BspLI	GGNNCC	1 cut(s)	300
BssECI	CCNNGG	3 cut(s)	139, 513, 514
BssMI	GATC	3 cut(s)	7, 178, 208
Bst2UI	CCWGG	1 cut(s)	515
Bst4CI	ACNGT	3 cut(s)	289, 356, 424
BstC8I	GCNNGC	1 cut(s)	460
BstDEI	CTNAG	1 cut(s)	389
BstF5I	GGATG	4 cut(s)	81, 211, 482, 499
BstKTI	GATC	3 cut(s)	10, 181, 211
BstMBI	GATC	3 cut(s)	7, 178, 208
BstMWI	GCNNNNNNNGC	1 cut(s)	58
BstNI	CCWGG	1 cut(s)	515
BstNSI	RCATGY	1 cut(s)	133
BstSCI	CCNGG	2 cut(s)	138, 513
BstSFI	CTRYAG	1 cut(s)	285
BstV2I	GAAGAC	2 cut(s)	195, 425
BsuRI	GGCC	1 cut(s)	342
BtrI	CACGTC	1 cut(s)	375
BtsCI	GGATG	4 cut(s)	81, 211, 482, 499
BtsIMutI	CAGTG	1 cut(s)	361
Cac8I	GCNNGC	1 cut(s)	460
CaiI	CAGNNNCTG	1 cut(s)	233
CciI	TCATGA	1 cut(s)	412
Cfr13I	GGNCC	1 cut(s)	341
Csp6I	GTAC	1 cut(s)	497
CviAII	CATG	2 cut(s)	130, 413
CviJI	RGCY	3 cut(s)	342, 450, 462
CviKI_1	RGCY	3 cut(s)	342, 450, 462
CviQI	GTAC	1 cut(s)	497
DdeI	CTNAG	1 cut(s)	389
DpnI	GATC	3 cut(s)	9, 180, 210
DpnII	GATC	3 cut(s)	7, 178, 208
Eco57I	CTGAAG	2 cut(s)	83, 318
Eco88I	CYCGRG	1 cut(s)	503
EcoRII	CCWGG	1 cut(s)	513
EcoT22I	ATGCAT	1 cut(s)	131
FaeI	CATG	2 cut(s)	133, 416
FaiI	YATR	7 cut(s)	131, 213, 380, 414, 434, 528, 544
FaqI	GGGAC	2 cut(s)	157, 275
FatI	CATG	2 cut(s)	129, 412
FbaI	TGATCA	1 cut(s)	208
FokI	GGATG	4 cut(s)	68, 218, 469, 486
FspBI	CTAG	1 cut(s)	165
HaeIII	GGCC	1 cut(s)	342
HapII	CCGG	1 cut(s)	139
Hin1II	CATG	2 cut(s)	133, 416
HinfI	GANTC	4 cut(s)	28, 230, 266, 398
HpaII	CCGG	1 cut(s)	139
HphI	GGTGA	1 cut(s)	5
Hpy188I	TCNGA	6 cut(s)	102, 241, 298, 337, 352, 490
Hpy188III	TCNNGA	6 cut(s)	85, 185, 388, 413, 441, 503
HpyAV	CCTTC	1 cut(s)	303
HpyCH4III	ACNGT	3 cut(s)	289, 356, 424
HpyCH4IV	ACGT	2 cut(s)	192, 374
HpyCH4V	TGCA	5 cut(s)	4, 34, 129, 227, 458
HpyF10VI	GCNNNNNNNGC	1 cut(s)	58
HpyF3I	CTNAG	1 cut(s)	389
HpySE526I	ACGT	2 cut(s)	192, 374
Hsp92II	CATG	2 cut(s)	133, 416
Ksp22I	TGATCA	1 cut(s)	208
Kzo9I	GATC	3 cut(s)	7, 178, 208
LweI	GCATC	3 cut(s)	43, 319, 485
MaeI	CTAG	1 cut(s)	165
MaeII	ACGT	2 cut(s)	192, 374
MaeIII	GTNAC	1 cut(s)	319
MalI	GATC	3 cut(s)	9, 180, 210
MboI	GATC	3 cut(s)	7, 178, 208
MboII	GAAGA	4 cut(s)	89, 200, 430, 471
MluCI	AATT	6 cut(s)	76, 160, 250, 404, 436, 519
MmeI	TCCRAC	1 cut(s)	348
MnlI	CCTC	8 cut(s)	18, 26, 160, 196, 352, 355, 487, 496
Mph1103I	ATGCAT	1 cut(s)	131
MslI	CAYNNNNRTG	1 cut(s)	377
MspI	CCGG	1 cut(s)	139
MspR9I	CCNGG	2 cut(s)	140, 515
MvaI	CCWGG	1 cut(s)	515
MwoI	GCNNNNNNNGC	1 cut(s)	58
NciI	CCSGG	1 cut(s)	140
NdeII	GATC	3 cut(s)	7, 178, 208
NlaIII	CATG	2 cut(s)	133, 416
NlaIV	GGNNCC	1 cut(s)	300
NsiI	ATGCAT	1 cut(s)	131
NspI	RCATGY	1 cut(s)	133
PagI	TCATGA	1 cut(s)	412
PasI	CCCWGGG	1 cut(s)	514
PfeI	GAWTC	4 cut(s)	28, 230, 266, 398
Psp6I	CCWGG	1 cut(s)	513
PspGI	CCWGG	1 cut(s)	513
PspN4I	GGNNCC	1 cut(s)	300
PspPI	GGNCC	1 cut(s)	341
PstNI	CAGNNNCTG	1 cut(s)	233
RsaI	GTAC	1 cut(s)	498
RsaNI	GTAC	1 cut(s)	497
RseI	CAYNNNNRTG	1 cut(s)	377
Sau3AI	GATC	3 cut(s)	7, 178, 208
Sau96I	GGNCC	1 cut(s)	341
ScrFI	CCNGG	2 cut(s)	140, 515
SetI	ASST	6 cut(s)	18, 195, 283, 377, 470, 498
SfaNI	GCATC	3 cut(s)	43, 319, 485
SfcI	CTRYAG	1 cut(s)	285
SmiMI	CAYNNNNRTG	1 cut(s)	377
Sse9I	AATT	6 cut(s)	76, 160, 250, 404, 436, 519
SspMI	CTAG	1 cut(s)	165
StyD4I	CCNGG	2 cut(s)	138, 513
TaaI	ACNGT	3 cut(s)	289, 356, 424
TaiI	ACGT	2 cut(s)	195, 377
TaqI	TCGA	1 cut(s)	117
TasI	AATT	6 cut(s)	76, 160, 250, 404, 436, 519
TfiI	GAWTC	4 cut(s)	28, 230, 266, 398
TscAI	CASTG	1 cut(s)	361
TspDTI	ATGAA	2 cut(s)	70, 471
TspRI	CASTG	1 cut(s)	361
XapI	RAATTY	3 cut(s)	76, 404, 436
XceI	RCATGY	1 cut(s)	133
XspI	CTAG	1 cut(s)	165
Zsp2I	ATGCAT	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.