Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007564.1

Orthogroup ID

OG0008176

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 448

Gene Structure 448 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007564.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 195 bp

ttaatagagaaattatctaccaaatcacctgatggccctaccaagatgaaaattttggctgcaattgcagaggaacataatgtcaaatgggatcccgaggcatttgaagagaagcctcctgaggacctgctggtaagaatggttcagctcttattcatttattcattgcttgatatagatgacataaaactatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04144 map04144

Pfam Domains

Protein Families

Ist1

Protein Analysis

64

Amino Acids

7.35

Weight (kDa)

4.64

Isoelectric Point (pI)

47.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008176)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0092741 RchiOBHm_Chr2g0092811 RchiOBHm_Chr6g0257341
rosa_multiflora	Rmu_co8093496.1_g000001 Rmu_sc0000915.1_g000001 Rmu_sc0001132.1_g000006 Rmu_sc0003262.1_g000004 Rmu_sc0003262.1_g000005 Rmu_sc0003262.1_g000006 Rmu_sc0004928.1_g000018 Rmu_sc0007564.1_g000001 Rmu_sc0013137.1_g000003 Rmu_sc0022170.1_g000001 Rmu_sc0037615.1_g000001
rosa_roxburghii	Rroxscaffold_2G00148880 Rroxscaffold_2G00148890
rosa_rugosa	Rorug02G0029200
rosa_samantha	Rh2AG074800 Rh2AG075000 Rh2AG075100 Rh2CG077800 Rh5CG321400 Rh5DG249300
rosa_wichuraiana	Rw2G005800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	135
AclWI	GGATC	2 cut(s)	86, 99
AcsI	RAATTY	1 cut(s)	51
AgsI	TTSAA	1 cut(s)	107
AluBI	AGCT	1 cut(s)	148
AluI	AGCT	1 cut(s)	148
AlwI	GGATC	2 cut(s)	86, 99
Ama87I	CYCGRG	1 cut(s)	95
AoxI	GGCC	1 cut(s)	34
ApeKI	GCWGC	1 cut(s)	59
ApoI	RAATTY	1 cut(s)	51
AspS9I	GGNCC	2 cut(s)	35, 124
AsuHPI	GGTGA	1 cut(s)	18
AvaI	CYCGRG	1 cut(s)	95
AvaII	GGWCC	1 cut(s)	124
AxyI	CCTNAGG	1 cut(s)	120
BamHI	GGATCC	1 cut(s)	91
BbvI	GCAGC	1 cut(s)	46
BccI	CCATC	1 cut(s)	26
BfmI	CTRYAG	1 cut(s)	191
BfuAI	ACCTGC	1 cut(s)	135
BisI	GCNGC	1 cut(s)	60
BlsI	GCNGC	1 cut(s)	61
Bme18I	GGWCC	1 cut(s)	124
BmeT110I	CYCGRG	1 cut(s)	95
BmgT120I	GGNCC	2 cut(s)	35, 124
BmiI	GGNNCC	1 cut(s)	93
BsaJI	CCNNGG	1 cut(s)	96
Bse21I	CCTNAGG	1 cut(s)	120
Bse3DI	GCAATG	1 cut(s)	164
BseDI	CCNNGG	1 cut(s)	96
BseMI	GCAATG	1 cut(s)	164
BseMII	CTCAG	1 cut(s)	111
BseXI	GCAGC	1 cut(s)	46
BshFI	GGCC	1 cut(s)	36
BsiHKCI	CYCGRG	1 cut(s)	95
BsnI	GGCC	1 cut(s)	36
BsoBI	CYCGRG	1 cut(s)	95
Bsp143I	GATC	1 cut(s)	91
BspANI	GGCC	1 cut(s)	36
BspCNI	CTCAG	1 cut(s)	112
BspLI	GGNNCC	1 cut(s)	93
BspMI	ACCTGC	1 cut(s)	135
BspPI	GGATC	2 cut(s)	86, 99
BsrDI	GCAATG	1 cut(s)	164
BssECI	CCNNGG	1 cut(s)	96
BssMI	GATC	1 cut(s)	91
Bst6I	CTCTTC	1 cut(s)	102
BstDEI	CTNAG	1 cut(s)	120
BstKTI	GATC	1 cut(s)	94
BstMBI	GATC	1 cut(s)	91
BstMWI	GCNNNNNNNGC	1 cut(s)	65
BstSFI	CTRYAG	1 cut(s)	191
BstV1I	GCAGC	1 cut(s)	46
BstX2I	RGATCY	1 cut(s)	91
BstYI	RGATCY	1 cut(s)	91
Bsu36I	CCTNAGG	1 cut(s)	120
BsuRI	GGCC	1 cut(s)	36
BveI	ACCTGC	1 cut(s)	135
Cfr13I	GGNCC	2 cut(s)	35, 124
CviJI	RGCY	4 cut(s)	36, 59, 115, 148
CviKI_1	RGCY	4 cut(s)	36, 59, 115, 148
DdeI	CTNAG	1 cut(s)	120
DpnI	GATC	1 cut(s)	93
DpnII	GATC	1 cut(s)	91
Eam1104I	CTCTTC	1 cut(s)	102
EarI	CTCTTC	1 cut(s)	102
Eco47I	GGWCC	1 cut(s)	124
Eco81I	CCTNAGG	1 cut(s)	120
Eco88I	CYCGRG	1 cut(s)	95
EcoO109I	RGGNCCY	1 cut(s)	124
FaiI	YATR	4 cut(s)	78, 176, 185, 193
Fnu4HI	GCNGC	1 cut(s)	60
Fsp4HI	GCNGC	1 cut(s)	60
GluI	GCNGC	1 cut(s)	60
HaeIII	GGCC	1 cut(s)	36
HphI	GGTGA	1 cut(s)	18
Hpy188III	TCNNGA	2 cut(s)	95, 119
HpyCH4V	TGCA	2 cut(s)	62, 68
HpyF10VI	GCNNNNNNNGC	1 cut(s)	65
HpyF3I	CTNAG	1 cut(s)	120
Kzo9I	GATC	1 cut(s)	91
LpnPI	CCDG	4 cut(s)	42, 116, 132, 140
Lsp1109I	GCAGC	1 cut(s)	46
MalI	GATC	1 cut(s)	93
MboI	GATC	1 cut(s)	91
MboII	GAAGA	1 cut(s)	119
MfeI	CAATTG	1 cut(s)	63
MflI	RGATCY	1 cut(s)	91
MluCI	AATT	3 cut(s)	11, 51, 63
MnlI	CCTC	4 cut(s)	64, 91, 115, 126
MseI	TTAA	1 cut(s)	2
MunI	CAATTG	1 cut(s)	63
MwoI	GCNNNNNNNGC	1 cut(s)	65
NdeII	GATC	1 cut(s)	91
NlaIV	GGNNCC	1 cut(s)	93
PkrI	GCNGC	1 cut(s)	61
PpuMI	RGGWCCY	1 cut(s)	124
Psp5II	RGGWCCY	1 cut(s)	124
PspN4I	GGNNCC	1 cut(s)	93
PspPI	GGNCC	2 cut(s)	35, 124
PspPPI	RGGWCCY	1 cut(s)	124
PsrI	GAACNNNNNNTAC	2 cut(s)	126, 158
PsuI	RGATCY	1 cut(s)	91
SaqAI	TTAA	1 cut(s)	2
SatI	GCNGC	1 cut(s)	60
Sau3AI	GATC	1 cut(s)	91
Sau96I	GGNCC	2 cut(s)	35, 124
SetI	ASST	3 cut(s)	31, 129, 150
SfcI	CTRYAG	1 cut(s)	191
SgeI	CNNG	8 cut(s)	41, 55, 107, 109, 131, 139, 143, 182
SinI	GGWCC	1 cut(s)	124
Sse9I	AATT	3 cut(s)	11, 51, 63
TasI	AATT	3 cut(s)	11, 51, 63
Tru1I	TTAA	1 cut(s)	2
Tru9I	TTAA	1 cut(s)	2
TseI	GCWGC	1 cut(s)	59
TspDTI	ATGAA	3 cut(s)	62, 145, 153
VpaK11BI	GGWCC	1 cut(s)	124
XapI	RAATTY	1 cut(s)	51

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.