Rmu_sc0003652.1_g000021

Coiled-coil domain containing protein (DUF2052)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003652.1
OG0006653
Physical Location & Seq
Forward (+)
81854 .. 83975
2122 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1086 bp
atggagacgaaggtagtgagaagcgaagcgatagagagcatatcggacaggctatcagcgtcggaggacctctacttccctcgcgccctgcaatccaccaccatcaccccctctcagcgcaaggccattctcctcgacctcctatcccgcgacgctgccgtcttcttagaacgttatggatcgaaattaacatctgaggagctcctggagtttgatgcgctgacagatgactatgaagtcagctggcatgtgaagcatcttagaagtttattgagtccgacatcggatgaattgaaatcaagggcagttcaagtgaagaacaggaggcgagcctacctgaataagttgatatttgatgggcagtatttctcggaggattcaatgagggagagagagccctacttgcatcatgagtatgtggggaagtttcaggatccgagtggtaggagcatggcaagacctggggagcggtggtcagatactttgttgaggaggtcagaggaagcgattttggtagcaaagattagaggggagcaacagaggttgggtgttgctgagagtgattgggttggcggtgagagaatccaggaagtagaggaacaggaggaggaagaagaagaggaggaagaggaagaggaagaggaagaagaagaggaggaggaggaggaggaagaatctaacgaggctaatgggggcacacaatcatcagagatgctggtagatcctcctaatgtggccagtggtgctgaaactgcagaccatccggatgcgcccaatgttgctcaagcaaccacagcagggcagagtgagcaagcaactgtatctgcagaagagttgcaagatctgatggaccagttcacctacatcatgcatgagaaatttttgttaggtgaagatcacgagtacttagattactcaaagatagacaacgacgagacattggatgatcactggcagagagaagccaaccatgacgctgaagagaagtactttgatgacattattgatgaggacgagacattggatgatcacccgcacagagaagtgaaccatgacgctgaagagaagtactttgatgaggattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2052

Protein Analysis

361

Amino Acids

41.8

Weight (kDa)

4.29

Isoelectric Point (pI)

73.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CCD97-like_C PF09747 107 - 333 2.5e-53 Coiled-coil domain containing protein 97-like, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 158, 236
AccBSI CCGCTC 1 cut(s) 469
AccII CGCG 2 cut(s) 84, 150
AccIII TCCGGA 1 cut(s) 763
AciI CCGC 4 cut(s) 148, 469, 573, 1034
AclI AACGTT 1 cut(s) 172
AclWI GGATC 4 cut(s) 187, 428, 441, 716
AcoI YGGCCR 1 cut(s) 735
AcsI RAATTY 1 cut(s) 878
AcuI CTGAAG 2 cut(s) 999, 1080
AfaI GTAC 3 cut(s) 905, 989, 1070
AfiI CCNNNNNNNGG 1 cut(s) 798
AgsI TTSAA 3 cut(s) 295, 311, 381
AjnI CCWGG 3 cut(s) 204, 460, 585
AluBI AGCT 2 cut(s) 202, 243
AluI AGCT 2 cut(s) 202, 243
Alw21I GWGCWC 1 cut(s) 204
Alw26I GTCTC 2 cut(s) 929, 1010
AlwI GGATC 4 cut(s) 187, 428, 441, 716
Aor13HI TCCGGA 1 cut(s) 763
AoxI GGCC 2 cut(s) 123, 735
ApeKI GCWGC 1 cut(s) 155
ApoI RAATTY 1 cut(s) 878
AspLEI GCGC 4 cut(s) 86, 120, 220, 772
AspS9I GGNCC 2 cut(s) 67, 850
AsuHPI GGTGA 5 cut(s) 97, 587, 850, 902, 1022
AvaII GGWCC 2 cut(s) 67, 850
BaeGI GKGCMC 1 cut(s) 698
BalI TGGCCA 1 cut(s) 737
BamHI GGATCC 1 cut(s) 433
BanII GRGCYC 2 cut(s) 204, 399
BauI CACGAG 1 cut(s) 899
BbsI GAAGAC 1 cut(s) 154
Bbv12I GWGCWC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 142
BccI CCATC 4 cut(s) 110, 350, 768, 841
BceAI ACGGC 1 cut(s) 143
BciT130I CCWGG 3 cut(s) 206, 462, 587
BclI TGATCA 2 cut(s) 946, 1027
BcoDI GTCTC 2 cut(s) 929, 1010
BfmI CTRYAG 2 cut(s) 753, 825
BglII AGATCT 1 cut(s) 841
BisI GCNGC 1 cut(s) 156
BlsI GCNGC 1 cut(s) 157
BmcAI AGTACT 3 cut(s) 905, 989, 1070
Bme1390I CCNGG 3 cut(s) 206, 462, 587
Bme18I GGWCC 2 cut(s) 67, 850
BmgT120I GGNCC 2 cut(s) 67, 850
BmiI GGNNCC 1 cut(s) 435
BmrFI CCNGG 3 cut(s) 206, 462, 587
BmsI GCATC 5 cut(s) 205, 265, 415, 702, 757
BpiI GAAGAC 1 cut(s) 154
BpmI CTGGAG 1 cut(s) 227
BpuEI CTTGAG 1 cut(s) 768
BsaJI CCNNGG 1 cut(s) 461
BsaWI WCCGGW 1 cut(s) 763
BsaXI ACNNNNNCTCC 2 cut(s) 458, 488
Bsc4I CCNNNNNNNGG 1 cut(s) 798
Bse1I ACTGG 3 cut(s) 738, 853, 956
BseAI TCCGGA 1 cut(s) 763
BseBI CCWGG 3 cut(s) 206, 462, 587
BseDI CCNNGG 1 cut(s) 461
BseGI GGATG 5 cut(s) 292, 760, 772, 949, 1030
BseLI CCNNNNNNNGG 1 cut(s) 798
BseMII CTCAG 3 cut(s) 128, 186, 546
BseNI ACTGG 3 cut(s) 738, 853, 956
BseSI GKGCMC 1 cut(s) 698
BseXI GCAGC 1 cut(s) 142
Bsh1236I CGCG 2 cut(s) 84, 150
BshFI GGCC 2 cut(s) 125, 737
BsiHKAI GWGCWC 1 cut(s) 204
BsiSI CCGG 1 cut(s) 764
BslI CCNNNNNNNGG 1 cut(s) 798
BsmAI GTCTC 2 cut(s) 929, 1010
BsnI GGCC 2 cut(s) 125, 737
Bsp1286I GDGCHC 3 cut(s) 204, 399, 698
Bsp13I TCCGGA 1 cut(s) 763
Bsp143I GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
BspACI CCGC 4 cut(s) 148, 469, 573, 1034
BspANI GGCC 2 cut(s) 125, 737
BspCNI CTCAG 3 cut(s) 127, 187, 547
BspEI TCCGGA 1 cut(s) 763
BspFNI CGCG 2 cut(s) 84, 150
BspHI TCATGA 1 cut(s) 409
BspLI GGNNCC 1 cut(s) 435
BspMAI CTGCAG 2 cut(s) 757, 829
BspPI GGATC 4 cut(s) 187, 428, 441, 716
BsrBI CCGCTC 1 cut(s) 469
BsrI ACTGG 3 cut(s) 738, 853, 956
BssECI CCNNGG 1 cut(s) 461
BssMI GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
BssSI CACGAG 1 cut(s) 899
Bst2BI CACGAG 1 cut(s) 899
Bst2UI CCWGG 3 cut(s) 206, 462, 587
Bst4CI ACNGT 1 cut(s) 820
Bst6I CTCTTC 8 cut(s) 612, 621, 627, 633, 645, 825, 975, 1056
BstC8I GCNNGC 3 cut(s) 245, 330, 813
BstDEI CTNAG 6 cut(s) 114, 166, 195, 260, 555, 907
BstF5I GGATG 5 cut(s) 292, 760, 772, 949, 1030
BstFNI CGCG 2 cut(s) 84, 150
BstHHI GCGC 4 cut(s) 86, 120, 220, 772
BstKTI GATC 7 cut(s) 182, 436, 724, 844, 898, 949, 1030
BstMAI GTCTC 2 cut(s) 929, 1010
BstMBI GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
BstMWI GCNNNNNNNGC 6 cut(s) 253, 403, 743, 752, 794, 808
BstNI CCWGG 3 cut(s) 206, 462, 587
BstNSI RCATGY 1 cut(s) 251
BstSCI CCNGG 3 cut(s) 204, 460, 585
BstSFI CTRYAG 2 cut(s) 753, 825
BstSLI GKGCMC 1 cut(s) 698
BstUI CGCG 2 cut(s) 84, 150
BstV1I GCAGC 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 154
BstX2I RGATCY 3 cut(s) 433, 721, 841
BstYI RGATCY 3 cut(s) 433, 721, 841
BsuRI GGCC 2 cut(s) 125, 737
BtsCI GGATG 5 cut(s) 292, 760, 772, 949, 1030
BtsIMutI CAGTG 2 cut(s) 745, 949
Cac8I GCNNGC 3 cut(s) 245, 330, 813
CciI TCATGA 1 cut(s) 409
CfoI GCGC 4 cut(s) 86, 120, 220, 772
Cfr13I GGNCC 2 cut(s) 67, 850
CseI GACGC 4 cut(s) 48, 161, 983, 1064
Csp6I GTAC 3 cut(s) 904, 988, 1069
CviAII CATG 7 cut(s) 248, 410, 451, 868, 872, 971, 1052
CviJI RGCY 9 cut(s) 52, 125, 202, 243, 332, 397, 686, 737, 965
CviKI_1 RGCY 9 cut(s) 52, 125, 202, 243, 332, 397, 686, 737, 965
CviQI GTAC 3 cut(s) 904, 988, 1069
DdeI CTNAG 6 cut(s) 114, 166, 195, 260, 555, 907
DpnI GATC 7 cut(s) 181, 435, 723, 843, 897, 948, 1029
DpnII GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
DrdI GACNNNNNNGTC 2 cut(s) 158, 236
DseDI GACNNNNNNGTC 2 cut(s) 158, 236
EaeI YGGCCR 1 cut(s) 735
Eam1104I CTCTTC 8 cut(s) 612, 621, 627, 633, 645, 825, 975, 1056
EarI CTCTTC 8 cut(s) 612, 621, 627, 633, 645, 825, 975, 1056
Ecl136II GAGCTC 1 cut(s) 202
Eco24I GRGCYC 2 cut(s) 204, 399
Eco47I GGWCC 2 cut(s) 67, 850
Eco53kI GAGCTC 1 cut(s) 202
Eco57I CTGAAG 2 cut(s) 999, 1080
EcoICRI GAGCTC 1 cut(s) 202
EcoO109I RGGNCCY 1 cut(s) 67
EcoRII CCWGG 3 cut(s) 204, 460, 585
EcoT22I ATGCAT 1 cut(s) 873
EcoT38I GRGCYC 2 cut(s) 204, 399
FaeI CATG 7 cut(s) 251, 413, 454, 871, 875, 974, 1055
FatI CATG 7 cut(s) 247, 409, 450, 867, 871, 970, 1051
FauI CCCGC 2 cut(s) 155, 1041
FbaI TGATCA 2 cut(s) 946, 1027
Fnu4HI GCNGC 1 cut(s) 156
FokI GGATG 5 cut(s) 299, 747, 779, 956, 1037
FriOI GRGCYC 2 cut(s) 204, 399
Fsp4HI GCNGC 1 cut(s) 156
GlaI GCGC 4 cut(s) 85, 119, 219, 771
GluI GCNGC 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 227
HaeIII GGCC 2 cut(s) 125, 737
HapII CCGG 1 cut(s) 764
HgaI GACGC 4 cut(s) 48, 161, 983, 1064
HhaI GCGC 4 cut(s) 86, 120, 220, 772
Hin1II CATG 7 cut(s) 251, 413, 454, 871, 875, 974, 1055
Hin6I GCGC 4 cut(s) 84, 118, 218, 770
HinP1I GCGC 4 cut(s) 84, 118, 218, 770
HinfI GANTC 4 cut(s) 274, 377, 582, 674
HpaII CCGG 1 cut(s) 764
HphI GGTGA 5 cut(s) 97, 587, 850, 902, 1022
Hpy166II GTNNAC 2 cut(s) 858, 1048
Hpy188III TCNNGA 4 cut(s) 410, 431, 764, 899
Hpy8I GTNNAC 2 cut(s) 858, 1048
Hpy99I CGWCG 3 cut(s) 64, 155, 935
HpyAV CCTTC 1 cut(s) 4
HpyCH4III ACNGT 1 cut(s) 820
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 6 cut(s) 91, 406, 755, 827, 838, 871
HpyF10VI GCNNNNNNNGC 6 cut(s) 253, 403, 743, 752, 794, 808
HpyF3I CTNAG 6 cut(s) 114, 166, 195, 260, 555, 907
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 7 cut(s) 251, 413, 454, 871, 875, 974, 1055
HspAI GCGC 4 cut(s) 84, 118, 218, 770
Kpn2I TCCGGA 1 cut(s) 763
Ksp22I TGATCA 2 cut(s) 946, 1027
Kzo9I GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
LmnI GCTCC 5 cut(s) 199, 207, 447, 466, 532
Lsp1109I GCAGC 1 cut(s) 142
LweI GCATC 5 cut(s) 205, 265, 415, 702, 757
MaeII ACGT 1 cut(s) 172
MalI GATC 7 cut(s) 181, 435, 723, 843, 897, 948, 1029
MbiI CCGCTC 1 cut(s) 469
MboI GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
MflI RGATCY 3 cut(s) 433, 721, 841
MhlI GDGCHC 3 cut(s) 204, 399, 698
MlsI TGGCCA 1 cut(s) 737
MluCI AATT 3 cut(s) 185, 290, 878
MluNI TGGCCA 1 cut(s) 737
MlyI GAGTC 1 cut(s) 283
MmeI TCCRAC 2 cut(s) 42, 302
Mox20I TGGCCA 1 cut(s) 737
Mph1103I ATGCAT 1 cut(s) 873
MroI TCCGGA 1 cut(s) 763
MscI TGGCCA 1 cut(s) 737
MseI TTAA 2 cut(s) 188, 1084
MslI CAYNNNNRTG 2 cut(s) 414, 765
Msp20I TGGCCA 1 cut(s) 737
MspA1I CMGCKG 1 cut(s) 243
MspI CCGG 1 cut(s) 764
MspR9I CCNGG 3 cut(s) 206, 462, 587
MvaI CCWGG 3 cut(s) 206, 462, 587
MvnI CGCG 2 cut(s) 84, 150
MwoI GCNNNNNNNGC 6 cut(s) 253, 403, 743, 752, 794, 808
NdeII GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
NlaIII CATG 7 cut(s) 251, 413, 454, 871, 875, 974, 1055
NlaIV GGNNCC 1 cut(s) 435
NsiI ATGCAT 1 cut(s) 873
NspI RCATGY 1 cut(s) 251
PagI TCATGA 1 cut(s) 409
PfeI GAWTC 3 cut(s) 377, 582, 674
PfoI TCCNGGA 2 cut(s) 204, 585
PkrI GCNGC 1 cut(s) 157
PleI GAGTC 1 cut(s) 282
PpsI GAGTC 1 cut(s) 282
PpuMI RGGWCCY 1 cut(s) 67
Psp124BI GAGCTC 1 cut(s) 204
Psp1406I AACGTT 1 cut(s) 172
Psp5II RGGWCCY 1 cut(s) 67
Psp6I CCWGG 3 cut(s) 204, 460, 585
PspGI CCWGG 3 cut(s) 204, 460, 585
PspN4I GGNNCC 1 cut(s) 435
PspPI GGNCC 2 cut(s) 67, 850
PspPPI RGGWCCY 1 cut(s) 67
PstI CTGCAG 2 cut(s) 757, 829
PsuI RGATCY 3 cut(s) 433, 721, 841
PvuII CAGCTG 1 cut(s) 243
RsaI GTAC 3 cut(s) 905, 989, 1070
RsaNI GTAC 3 cut(s) 904, 988, 1069
RseI CAYNNNNRTG 2 cut(s) 414, 765
SacI GAGCTC 1 cut(s) 204
SaqAI TTAA 2 cut(s) 188, 1084
SatI GCNGC 1 cut(s) 156
Sau3AI GATC 7 cut(s) 179, 433, 721, 841, 895, 946, 1027
Sau96I GGNCC 2 cut(s) 67, 850
ScaI AGTACT 3 cut(s) 905, 989, 1070
SchI GAGTC 1 cut(s) 283
ScrFI CCNGG 3 cut(s) 206, 462, 587
SduI GDGCHC 3 cut(s) 204, 399, 698
SfaNI GCATC 5 cut(s) 205, 265, 415, 702, 757
SfcI CTRYAG 2 cut(s) 753, 825
SinI GGWCC 2 cut(s) 67, 850
SmiMI CAYNNNNRTG 2 cut(s) 414, 765
SmlI CTYRAG 1 cut(s) 783
SmoI CTYRAG 1 cut(s) 783
Sse9I AATT 3 cut(s) 185, 290, 878
SsiI CCGC 4 cut(s) 148, 469, 573, 1034
SstI GAGCTC 1 cut(s) 204
StyD4I CCNGG 3 cut(s) 204, 460, 585
TaaI ACNGT 1 cut(s) 820
TaiI ACGT 1 cut(s) 175
TaqI TCGA 2 cut(s) 135, 182
TasI AATT 3 cut(s) 185, 290, 878
TatI WGTACW 3 cut(s) 903, 987, 1068
TfiI GAWTC 3 cut(s) 377, 582, 674
Tru1I TTAA 2 cut(s) 188, 1084
Tru9I TTAA 2 cut(s) 188, 1084
TscAI CASTG 2 cut(s) 745, 956
TseI GCWGC 1 cut(s) 155
TspDTI ATGAA 2 cut(s) 249, 303
TspRI CASTG 2 cut(s) 745, 956
VpaK11BI GGWCC 2 cut(s) 67, 850
XapI RAATTY 1 cut(s) 878
XceI RCATGY 1 cut(s) 251
ZrmI AGTACT 3 cut(s) 905, 989, 1070
Zsp2I ATGCAT 1 cut(s) 873
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.