Rmu_sc0004222.1_g000003

glyoxalase I family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004222.1
Physical Location & Seq
Forward (+)
2787 .. 3112
326 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004222.1_g000003.1.cds

Sequence Viewer

Length: 240 bp
atggggtttgcctatgacttaaactggcagctgctaatcaagcttcacagtgaccatgccatgcagaagggctactcttcccttgtatctttcacagtgttggacattaaccaaacggtgacgaagctaatggcattaggagctgagctagatggtcctatcaaatacgaaatccatgggaaggttgctgccctgcgatgtattgatgggcacatgttaggcctctatgaaccagcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.76

Weight (kDa)

6.0

Isoelectric Point (pI)

10.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 181
AflIII ACRYGT 1 cut(s) 213
AluBI AGCT 5 cut(s) 31, 43, 127, 143, 148
AluI AGCT 5 cut(s) 31, 43, 127, 143, 148
AoxI GGCC 1 cut(s) 220
ApeKI GCWGC 3 cut(s) 28, 31, 188
AspS9I GGNCC 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 130
AvaII GGWCC 1 cut(s) 155
BaeGI GKGCMC 1 cut(s) 213
BbvI GCAGC 3 cut(s) 18, 40, 175
BccI CCATC 2 cut(s) 146, 200
BfaI CTAG 1 cut(s) 149
BisI GCNGC 3 cut(s) 29, 32, 189
BlpI GCTNAGC 1 cut(s) 144
BlsI GCNGC 3 cut(s) 30, 33, 190
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 155
Bpu1102I GCTNAGC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 1 cut(s) 29
BseSI GKGCMC 1 cut(s) 213
BseXI GCAGC 3 cut(s) 18, 40, 175
BshFI GGCC 1 cut(s) 222
BslI CCNNNNNNNGG 1 cut(s) 181
BsnI GGCC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 213
Bsp1720I GCTNAGC 1 cut(s) 144
Bsp19I CCATGG 1 cut(s) 175
BspANI GGCC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 136
BsrI ACTGG 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 175
Bst4CI ACNGT 3 cut(s) 50, 97, 118
Bst6I CTCTTC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 144
BstDSI CCRYGG 1 cut(s) 175
BstMWI GCNNNNNNNGC 2 cut(s) 40, 140
BstNSI RCATGY 1 cut(s) 217
BstSLI GKGCMC 1 cut(s) 213
BstV1I GCAGC 3 cut(s) 18, 40, 175
BsuRI GGCC 1 cut(s) 222
BtgI CCRYGG 1 cut(s) 175
BtgZI GCGATG 1 cut(s) 211
BtsIMutI CAGTG 2 cut(s) 55, 102
Cfr13I GGNCC 1 cut(s) 155
CviAII CATG 4 cut(s) 56, 61, 176, 214
CviJI RGCY 7 cut(s) 31, 43, 72, 127, 143, 148, 222
CviKI_1 RGCY 7 cut(s) 31, 43, 72, 127, 143, 148, 222
DdeI CTNAG 1 cut(s) 144
Eam1104I CTCTTC 1 cut(s) 82
EarI CTCTTC 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 175
Eco147I AGGCCT 1 cut(s) 222
Eco47I GGWCC 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 4 cut(s) 59, 64, 179, 217
FaiI YATR 6 cut(s) 15, 57, 62, 177, 215, 228
FatI CATG 4 cut(s) 55, 60, 175, 213
Fnu4HI GCNGC 3 cut(s) 29, 32, 189
Fsp4HI GCNGC 3 cut(s) 29, 32, 189
FspBI CTAG 1 cut(s) 149
GluI GCNGC 3 cut(s) 29, 32, 189
HaeIII GGCC 1 cut(s) 222
Hin1II CATG 4 cut(s) 59, 64, 179, 217
HindIII AAGCTT 1 cut(s) 41
HphI GGTGA 1 cut(s) 130
HpyAV CCTTC 2 cut(s) 61, 175
HpyCH4III ACNGT 3 cut(s) 50, 97, 118
HpyCH4V TGCA 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 140
HpyF3I CTNAG 1 cut(s) 144
Hsp92II CATG 4 cut(s) 59, 64, 179, 217
LmnI GCTCC 1 cut(s) 140
LpnPI CCDG 2 cut(s) 10, 206
Lsp1109I GCAGC 3 cut(s) 18, 40, 175
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 2 cut(s) 50, 118
MboII GAAGA 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 213
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 1 cut(s) 233
MseI TTAA 2 cut(s) 20, 108
MspA1I CMGCKG 1 cut(s) 31
MwoI GCNNNNNNNGC 2 cut(s) 40, 140
NcoI CCATGG 1 cut(s) 175
NlaIII CATG 4 cut(s) 59, 64, 179, 217
NmuCI GTSAC 2 cut(s) 50, 118
NspI RCATGY 1 cut(s) 217
PceI AGGCCT 1 cut(s) 222
PciI ACATGT 1 cut(s) 213
PkrI GCNGC 3 cut(s) 30, 33, 190
PscI ACATGT 1 cut(s) 213
PspPI GGNCC 1 cut(s) 155
PvuII CAGCTG 1 cut(s) 31
SaqAI TTAA 2 cut(s) 20, 108
SatI GCNGC 3 cut(s) 29, 32, 189
Sau96I GGNCC 1 cut(s) 155
SduI GDGCHC 1 cut(s) 213
SetI ASST 6 cut(s) 33, 45, 129, 145, 150, 186
SgeI CNNG 9 cut(s) 37, 52, 68, 73, 95, 161, 188, 205, 226
SinI GGWCC 1 cut(s) 155
SseBI AGGCCT 1 cut(s) 222
SspMI CTAG 1 cut(s) 149
StuI AGGCCT 1 cut(s) 222
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 3 cut(s) 50, 97, 118
Tru1I TTAA 2 cut(s) 20, 108
Tru9I TTAA 2 cut(s) 20, 108
TscAI CASTG 2 cut(s) 55, 102
TseFI GTSAC 2 cut(s) 50, 118
TseI GCWGC 3 cut(s) 28, 31, 188
Tsp45I GTSAC 2 cut(s) 50, 118
TspRI CASTG 2 cut(s) 55, 102
VpaK11BI GGWCC 1 cut(s) 155
XceI RCATGY 1 cut(s) 217
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.