Rmu_sc0007157.1_g000006

Sulfiredoxin, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007157.1
Physical Location & Seq
Forward (+)
14978 .. 15330
353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007157.1_g000006.1.cds

Sequence Viewer

Length: 270 bp
atggccaattttgttctgcaagttccaaatagcctgaggagcttcaccatttcagcctctgcttcatctaatgggtctcctcctttgagttctagtggtagtagtggtgggggtggtggtcctgtgatattggagcttcctgttgataagataaggaggcctttgatgagaaccagagctaatgatccggtcaaggttcaagaactgatggatagcataagtgaaattggcctccaagtacctgtaagtattggtagcaaacccaattag

Protein Analysis

89

Amino Acids

9.2

Weight (kDa)

9.68

Isoelectric Point (pI)

69.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 179
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 240
AgsI TTSAA 1 cut(s) 200
AluBI AGCT 3 cut(s) 42, 136, 179
AluI AGCT 3 cut(s) 42, 136, 179
Alw26I GTCTC 1 cut(s) 81
AlwI GGATC 1 cut(s) 179
AlwNI CAGNNNCTG 1 cut(s) 59
AoxI GGCC 3 cut(s) 3, 158, 229
AspS9I GGNCC 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 37
AvaII GGWCC 1 cut(s) 119
AxyI CCTNAGG 1 cut(s) 35
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 202
BcoDI GTCTC 1 cut(s) 81
BfaI CTAG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BsaI GGTCTC 1 cut(s) 81
BsaWI WCCGGW 1 cut(s) 187
Bse21I CCTNAGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 26
BseRI GAGGAG 2 cut(s) 52, 69
BshFI GGCC 3 cut(s) 5, 160, 231
BsiSI CCGG 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 81
BsnI GGCC 3 cut(s) 5, 160, 231
Bso31I GGTCTC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 184
BspANI GGCC 3 cut(s) 5, 160, 231
BspCNI CTCAG 1 cut(s) 27
BspPI GGATC 1 cut(s) 179
BspTNI GGTCTC 1 cut(s) 81
BssMI GATC 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 35
BstKTI GATC 1 cut(s) 187
BstMAI GTCTC 1 cut(s) 81
BstMBI GATC 1 cut(s) 184
BstMWI GCNNNNNNNGC 1 cut(s) 39
Bsu36I CCTNAGG 1 cut(s) 35
BsuRI GGCC 3 cut(s) 5, 160, 231
CaiI CAGNNNCTG 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 239
CviJI RGCY 8 cut(s) 5, 33, 42, 56, 136, 160, 179, 231
CviKI_1 RGCY 8 cut(s) 5, 33, 42, 56, 136, 160, 179, 231
CviQI GTAC 1 cut(s) 239
DdeI CTNAG 1 cut(s) 35
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
EaeI YGGCCR 1 cut(s) 3
Eco147I AGGCCT 1 cut(s) 160
Eco31I GGTCTC 1 cut(s) 81
Eco47I GGWCC 1 cut(s) 119
Eco81I CCTNAGG 1 cut(s) 35
FaiI YATR 1 cut(s) 218
FalI AAGNNNNNCTT 2 cut(s) 145, 177
FspBI CTAG 1 cut(s) 93
HaeIII GGCC 3 cut(s) 5, 160, 231
HapII CCGG 1 cut(s) 188
HpaII CCGG 1 cut(s) 188
HphI GGTGA 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 200
HpyCH4V TGCA 1 cut(s) 19
HpyF10VI GCNNNNNNNGC 1 cut(s) 39
HpyF3I CTNAG 1 cut(s) 35
Kzo9I GATC 1 cut(s) 184
LmnI GCTCC 2 cut(s) 39, 133
LpnPI CCDG 6 cut(s) 47, 135, 153, 187, 201, 255
MaeI CTAG 1 cut(s) 93
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 7, 225, 265
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 5 cut(s) 30, 67, 90, 150, 242
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 39
NdeII GATC 1 cut(s) 184
PceI AGGCCT 1 cut(s) 160
PspPI GGNCC 1 cut(s) 119
PstNI CAGNNNCTG 1 cut(s) 59
RsaI GTAC 1 cut(s) 240
RsaNI GTAC 1 cut(s) 239
Sau3AI GATC 1 cut(s) 184
Sau96I GGNCC 1 cut(s) 119
SetI ASST 5 cut(s) 44, 138, 181, 198, 244
SinI GGWCC 1 cut(s) 119
Sse9I AATT 3 cut(s) 7, 225, 265
SseBI AGGCCT 1 cut(s) 160
SspMI CTAG 1 cut(s) 93
StuI AGGCCT 1 cut(s) 160
TasI AATT 3 cut(s) 7, 225, 265
TspDTI ATGAA 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 119
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.