Rw6G003940

Sulfiredoxin, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
6426892 .. 6428036
1145 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G003940.1

Sequence Viewer

Length: 282 bp
ATGAGGAGCTTCACCATTTCAGCTTCTGCTTCATCTAATGGGTCTCCTCCTTTGAGTTCTAGTGGTAGTAGTGGTGGGGGTGGCGGTCCTATGATATTGGAAACTAATGATCCGGTCAAGGTTCAAGAACTGATGGATATCATAAGTGAAATTGGCCTCCAAGTACCTGTAAGTTTCTCTGGATGTCATCGCTATGAAGCTCACCAGCGTCTTAGGCTCCTAACAATACGTTGCAAAATTCGACGTGGGACAAAAGAAACTCTCCGGCATCACCTATGCTGA

Protein Analysis

93

Amino Acids

10.05

Weight (kDa)

9.41

Isoelectric Point (pI)

56.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 84
AclWI GGATC 1 cut(s) 104
AcsI RAATTY 1 cut(s) 237
AfaI GTAC 1 cut(s) 165
AgsI TTSAA 1 cut(s) 125
AjiI CACGTC 1 cut(s) 245
AluBI AGCT 3 cut(s) 9, 23, 200
AluI AGCT 3 cut(s) 9, 23, 200
Alw26I GTCTC 1 cut(s) 48
AlwI GGATC 1 cut(s) 104
AlwNI CAGNNNCTG 1 cut(s) 26
AoxI GGCC 1 cut(s) 154
ApoI RAATTY 1 cut(s) 237
AspS9I GGNCC 1 cut(s) 86
AsuHPI GGTGA 3 cut(s) 4, 194, 263
AvaII GGWCC 1 cut(s) 86
BccI CCATC 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 48
BfaI CTAG 1 cut(s) 60
Bme18I GGWCC 1 cut(s) 86
BmgBI CACGTC 1 cut(s) 245
BmgT120I GGNCC 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 218
BmsI GCATC 1 cut(s) 277
BsaBI GATNNNNATC 1 cut(s) 137
BsaI GGTCTC 1 cut(s) 48
BsaWI WCCGGW 1 cut(s) 112
Bse8I GATNNNNATC 1 cut(s) 137
BseGI GGATG 1 cut(s) 188
BseJI GATNNNNATC 1 cut(s) 137
BseRI GAGGAG 2 cut(s) 19, 36
BshFI GGCC 1 cut(s) 156
BsiSI CCGG 2 cut(s) 113, 265
BslFI GGGAC 1 cut(s) 262
BsmAI GTCTC 1 cut(s) 48
BsmFI GGGAC 1 cut(s) 262
BsnI GGCC 1 cut(s) 156
Bso31I GGTCTC 1 cut(s) 48
Bsp143I GATC 1 cut(s) 109
BspACI CCGC 1 cut(s) 84
BspANI GGCC 1 cut(s) 156
BspLI GGNNCC 1 cut(s) 218
BspPI GGATC 1 cut(s) 104
BspTNI GGTCTC 1 cut(s) 48
BssMI GATC 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 212
BstF5I GGATG 1 cut(s) 188
BstKTI GATC 1 cut(s) 112
BstMAI GTCTC 1 cut(s) 48
BstMBI GATC 1 cut(s) 109
BstMWI GCNNNNNNNGC 1 cut(s) 214
BsuRI GGCC 1 cut(s) 156
BtgZI GCGATG 1 cut(s) 173
BtrI CACGTC 1 cut(s) 245
BtsCI GGATG 1 cut(s) 188
CaiI CAGNNNCTG 1 cut(s) 26
Cfr13I GGNCC 1 cut(s) 86
CseI GACGC 1 cut(s) 197
Csp6I GTAC 1 cut(s) 164
CviJI RGCY 5 cut(s) 9, 23, 156, 200, 217
CviKI_1 RGCY 5 cut(s) 9, 23, 156, 200, 217
CviQI GTAC 1 cut(s) 164
DdeI CTNAG 1 cut(s) 212
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco31I GGTCTC 1 cut(s) 48
Eco32I GATATC 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 86
EcoRV GATATC 1 cut(s) 139
FaiI YATR 4 cut(s) 92, 143, 195, 277
FaqI GGGAC 1 cut(s) 262
FokI GGATG 1 cut(s) 195
FspBI CTAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 156
HapII CCGG 2 cut(s) 113, 265
HgaI GACGC 1 cut(s) 197
HpaII CCGG 2 cut(s) 113, 265
HphI GGTGA 3 cut(s) 4, 194, 263
Hpy188III TCNNGA 2 cut(s) 125, 180
Hpy99I CGWCG 1 cut(s) 246
HpyCH4IV ACGT 2 cut(s) 229, 244
HpyCH4V TGCA 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpyF3I CTNAG 1 cut(s) 212
HpySE526I ACGT 2 cut(s) 229, 244
Kzo9I GATC 1 cut(s) 109
LmnI GCTCC 2 cut(s) 6, 222
LpnPI CCDG 5 cut(s) 126, 165, 180, 218, 278
LweI GCATC 1 cut(s) 277
MaeI CTAG 1 cut(s) 60
MaeII ACGT 2 cut(s) 229, 244
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MluCI AATT 2 cut(s) 150, 237
MnlI CCTC 2 cut(s) 57, 167
MslI CAYNNNNRTG 1 cut(s) 192
MspI CCGG 2 cut(s) 113, 265
MwoI GCNNNNNNNGC 1 cut(s) 214
NdeII GATC 1 cut(s) 109
NlaIV GGNNCC 1 cut(s) 218
PspN4I GGNNCC 1 cut(s) 218
PspPI GGNCC 1 cut(s) 86
PstNI CAGNNNCTG 1 cut(s) 26
RsaI GTAC 1 cut(s) 165
RsaNI GTAC 1 cut(s) 164
RseI CAYNNNNRTG 1 cut(s) 192
Sau3AI GATC 1 cut(s) 109
Sau96I GGNCC 1 cut(s) 86
SetI ASST 8 cut(s) 11, 25, 123, 169, 202, 232, 247, 276
SfaNI GCATC 1 cut(s) 277
SinI GGWCC 1 cut(s) 86
SmiMI CAYNNNNRTG 1 cut(s) 192
Sse9I AATT 2 cut(s) 150, 237
SsiI CCGC 1 cut(s) 84
SspMI CTAG 1 cut(s) 60
TaiI ACGT 2 cut(s) 232, 247
TaqI TCGA 1 cut(s) 241
TasI AATT 2 cut(s) 150, 237
TspDTI ATGAA 2 cut(s) 21, 210
VpaK11BI GGWCC 1 cut(s) 86
XapI RAATTY 1 cut(s) 237
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.