Rmu_sc0015732.1_g000001

Sulfiredoxin, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015732.1
Physical Location & Seq
Forward (+)
1 .. 883
883 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015732.1_g000001.1.cds

Sequence Viewer

Length: 197 bp
ggtctccctctttgagttctagtggtagtagtggtgggggtggcggtcctgtgatattggagcttcctattgataagataaggaggcctttgatgagaaccagaactaatgatccggtcaaggttcaagaactgatggatagcataagtgaaattggcctccaagtacctgtacgtattggtaacaaactcaattag

Protein Analysis

64

Amino Acids

6.77

Weight (kDa)

9.68

Isoelectric Point (pI)

75.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AclWI GGATC 1 cut(s) 106
AfaI GTAC 2 cut(s) 167, 173
AgsI TTSAA 1 cut(s) 127
AloI GAACNNNNNNTCC 2 cut(s) 96, 128
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
Alw26I GTCTC 1 cut(s) 8
AlwI GGATC 1 cut(s) 106
AoxI GGCC 2 cut(s) 85, 156
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BccI CCATC 1 cut(s) 129
BcoDI GTCTC 1 cut(s) 8
BfaI CTAG 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BsaAI YACGTR 1 cut(s) 175
BsaI GGTCTC 1 cut(s) 8
BsaWI WCCGGW 1 cut(s) 114
BshFI GGCC 2 cut(s) 87, 158
BsiSI CCGG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 8
BsnI GGCC 2 cut(s) 87, 158
Bso31I GGTCTC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 111
BspACI CCGC 1 cut(s) 44
BspANI GGCC 2 cut(s) 87, 158
BspPI GGATC 1 cut(s) 106
BspTNI GGTCTC 1 cut(s) 8
BssMI GATC 1 cut(s) 111
BstBAI YACGTR 1 cut(s) 175
BstKTI GATC 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 8
BstMBI GATC 1 cut(s) 111
BstSNI TACGTA 1 cut(s) 175
BsuRI GGCC 2 cut(s) 87, 158
Cfr13I GGNCC 1 cut(s) 46
Csp6I GTAC 2 cut(s) 166, 172
CviJI RGCY 3 cut(s) 63, 87, 158
CviKI_1 RGCY 3 cut(s) 63, 87, 158
CviQI GTAC 2 cut(s) 166, 172
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eco105I TACGTA 1 cut(s) 175
Eco147I AGGCCT 1 cut(s) 87
Eco31I GGTCTC 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 46
FaiI YATR 1 cut(s) 145
FalI AAGNNNNNCTT 2 cut(s) 72, 104
FspBI CTAG 1 cut(s) 20
HaeIII GGCC 2 cut(s) 87, 158
HapII CCGG 1 cut(s) 115
HpaII CCGG 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 174
HpySE526I ACGT 1 cut(s) 174
Kzo9I GATC 1 cut(s) 111
LmnI GCTCC 1 cut(s) 60
LpnPI CCDG 4 cut(s) 62, 114, 128, 182
MaeI CTAG 1 cut(s) 20
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 181
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MluCI AATT 2 cut(s) 152, 192
MnlI CCTC 3 cut(s) 18, 77, 169
MspI CCGG 1 cut(s) 115
NdeII GATC 1 cut(s) 111
PceI AGGCCT 1 cut(s) 87
Ppu21I YACGTR 1 cut(s) 175
PspPI GGNCC 1 cut(s) 46
RsaI GTAC 2 cut(s) 167, 173
RsaNI GTAC 2 cut(s) 166, 172
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 46
SetI ASST 4 cut(s) 65, 125, 171, 177
SgeI CNNG 8 cut(s) 32, 61, 113, 127, 132, 139, 175, 181
SinI GGWCC 1 cut(s) 46
SnaBI TACGTA 1 cut(s) 175
Sse9I AATT 2 cut(s) 152, 192
SseBI AGGCCT 1 cut(s) 87
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 20
StuI AGGCCT 1 cut(s) 87
TaiI ACGT 1 cut(s) 177
TasI AATT 2 cut(s) 152, 192
VpaK11BI GGWCC 1 cut(s) 46
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.