Rh2CG316100

Sulfiredoxin, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
40152702 .. 40153105
404 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG316100.1

Sequence Viewer

Length: 183 bp
ATGAGAACCAGAACTAATGATCCGGTCAAGGTTCAAGAACTGATGGATAGCATAAGTGAAATTGGCCTCCAAGTACCTATTGATGTGCTTGAGGTCGATGGAGTTTATTATGGTATGTGCTTATCATTATTCTTTATATTTCTCCCTTACAAACCATTGGAGTGCTCTATTTTTAAATTTTGA

Protein Analysis

60

Amino Acids

6.95

Weight (kDa)

4.51

Isoelectric Point (pI)

34.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 14
AcsI RAATTY 1 cut(s) 176
AfaI GTAC 1 cut(s) 75
AgsI TTSAA 1 cut(s) 35
AloI GAACNNNNNNTCC 1 cut(s) 36
Alw21I GWGCWC 1 cut(s) 167
AlwI GGATC 1 cut(s) 14
AoxI GGCC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 176
Bbv12I GWGCWC 1 cut(s) 167
BccI CCATC 2 cut(s) 37, 92
BpuEI CTTGAG 1 cut(s) 110
BsaWI WCCGGW 1 cut(s) 22
BshFI GGCC 1 cut(s) 66
BsiHKAI GWGCWC 1 cut(s) 167
BsiSI CCGG 1 cut(s) 23
BsnI GGCC 1 cut(s) 66
Bsp1286I GDGCHC 1 cut(s) 167
Bsp143I GATC 1 cut(s) 19
BspANI GGCC 1 cut(s) 66
BspPI GGATC 1 cut(s) 14
BssMI GATC 1 cut(s) 19
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BsuRI GGCC 1 cut(s) 66
Csp6I GTAC 1 cut(s) 74
CviJI RGCY 1 cut(s) 66
CviKI_1 RGCY 1 cut(s) 66
CviQI GTAC 1 cut(s) 74
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
DraI TTTAAA 1 cut(s) 175
FaiI YATR 4 cut(s) 53, 111, 116, 137
HaeIII GGCC 1 cut(s) 66
HapII CCGG 1 cut(s) 23
HpaII CCGG 1 cut(s) 23
Hpy188III TCNNGA 1 cut(s) 35
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 2 cut(s) 22, 36
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 167
MluCI AATT 2 cut(s) 60, 176
MnlI CCTC 2 cut(s) 77, 85
MseI TTAA 1 cut(s) 174
MslI CAYNNNNRTG 1 cut(s) 160
MspI CCGG 1 cut(s) 23
NdeII GATC 1 cut(s) 19
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
RseI CAYNNNNRTG 1 cut(s) 160
SaqAI TTAA 1 cut(s) 174
Sau3AI GATC 1 cut(s) 19
SduI GDGCHC 1 cut(s) 167
SetI ASST 3 cut(s) 33, 79, 96
SgeI CNNG 6 cut(s) 21, 35, 40, 47, 83, 101
SmiMI CAYNNNNRTG 1 cut(s) 160
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 2 cut(s) 60, 176
TaqI TCGA 1 cut(s) 96
TasI AATT 2 cut(s) 60, 176
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
XapI RAATTY 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.