Rmu_sc0008653.1_g000003

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008653.1
Physical Location & Seq
Reverse (-)
8876 .. 11592
2717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008653.1_g000003.1.cds

Sequence Viewer

Length: 558 bp
atgttaggtttggcagcaaggttcttgaaatggctacagcgacctacccacctccaccaccgtattataagctatacaaagattacttgcaagatcccaaatccgctcctgagccgccgccaccaattgaagggacatacatttgctatggtgctaattacaccacagatgacggtgcttccaagcttggaagaacagggagtgcgtcaactgtacccaaaaggcccaaatattgattttaagaaggaactgaggtcccttaacagagaattgcagctgcacattttggaacttgctgatattctcgtggagagaccatcacaatatgcaaggagagtggaagaaatatctcttatattcaagaacttgcatcatcttctgaactcattgcggccccatcaggctagggcaacactaattcacattctagaacttcagattaaacgacgtaaacaagctgttgaggatataaagaggaggagagaagaagcacaggcacttctgaaggagtcccttgaatcgttggaggacactggtgcatctcttatgttgaaatag

Protein Analysis

185

Amino Acids

21.67

Weight (kDa)

10.2

Isoelectric Point (pI)

66.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 68
AccBSI CCGCTC 1 cut(s) 106
AciI CCGC 4 cut(s) 104, 115, 118, 391
AclWI GGATC 1 cut(s) 88
AcuI CTGAAG 2 cut(s) 419, 524
AfaI GTAC 1 cut(s) 215
AfiI CCNNNNNNNGG 1 cut(s) 130
AgsI TTSAA 5 cut(s) 28, 130, 361, 518, 553
AluBI AGCT 4 cut(s) 72, 186, 277, 458
AluI AGCT 4 cut(s) 72, 186, 277, 458
Alw26I GTCTC 1 cut(s) 307
AlwI GGATC 1 cut(s) 88
AoxI GGCC 2 cut(s) 223, 392
ApeKI GCWGC 3 cut(s) 14, 274, 277
AspS9I GGNCC 3 cut(s) 224, 255, 393
AvaII GGWCC 1 cut(s) 255
BauI CACGAG 1 cut(s) 305
BbvI GCAGC 3 cut(s) 26, 264, 286
BccI CCATC 2 cut(s) 325, 405
BcoDI GTCTC 1 cut(s) 307
BfaI CTAG 2 cut(s) 405, 428
BfmI CTRYAG 1 cut(s) 35
BisI GCNGC 6 cut(s) 15, 115, 118, 275, 278, 392
BlsI GCNGC 6 cut(s) 16, 116, 119, 276, 279, 393
Bme18I GGWCC 1 cut(s) 255
BmgT120I GGNCC 3 cut(s) 224, 255, 393
BmiI GGNNCC 2 cut(s) 257, 395
BmsI GCATC 2 cut(s) 379, 548
Bpu10I CCTNAGC 1 cut(s) 110
BsaI GGTCTC 1 cut(s) 307
Bsc4I CCNNNNNNNGG 1 cut(s) 130
Bse1I ACTGG 1 cut(s) 538
Bse3DI GCAATG 1 cut(s) 386
BseLI CCNNNNNNNGG 1 cut(s) 130
BseMI GCAATG 1 cut(s) 386
BseMII CTCAG 2 cut(s) 101, 242
BseNI ACTGG 1 cut(s) 538
BseRI GAGGAG 2 cut(s) 490, 493
BseXI GCAGC 3 cut(s) 26, 264, 286
BsgI GTGCAG 1 cut(s) 263
BshFI GGCC 2 cut(s) 225, 394
BslFI GGGAC 3 cut(s) 147, 241, 496
BslI CCNNNNNNNGG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 307
BsmFI GGGAC 3 cut(s) 147, 241, 496
BsnI GGCC 2 cut(s) 225, 394
Bso31I GGTCTC 1 cut(s) 307
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 4 cut(s) 104, 115, 118, 391
BspANI GGCC 2 cut(s) 225, 394
BspCNI CTCAG 2 cut(s) 102, 243
BspLI GGNNCC 2 cut(s) 257, 395
BspPI GGATC 1 cut(s) 88
BspTNI GGTCTC 1 cut(s) 307
BsrBI CCGCTC 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 386
BsrI ACTGG 1 cut(s) 538
BssMI GATC 1 cut(s) 93
BssSI CACGAG 1 cut(s) 305
Bst2BI CACGAG 1 cut(s) 305
Bst4CI ACNGT 3 cut(s) 62, 175, 213
BstDEI CTNAG 2 cut(s) 110, 251
BstKTI GATC 1 cut(s) 96
BstMAI GTCTC 1 cut(s) 307
BstMBI GATC 1 cut(s) 93
BstSFI CTRYAG 1 cut(s) 35
BstV1I GCAGC 3 cut(s) 26, 264, 286
BstX2I RGATCY 1 cut(s) 93
BstYI RGATCY 1 cut(s) 93
BsuRI GGCC 2 cut(s) 225, 394
BtsIMutI CAGTG 1 cut(s) 531
Cfr13I GGNCC 3 cut(s) 224, 255, 393
CseI GACGC 1 cut(s) 194
Csp6I GTAC 1 cut(s) 214
CspCI CAANNNNNGTGG 2 cut(s) 318, 353
CviJI RGCY 9 cut(s) 34, 72, 114, 186, 225, 277, 394, 404, 458
CviKI_1 RGCY 9 cut(s) 34, 72, 114, 186, 225, 277, 394, 404, 458
CviQI GTAC 1 cut(s) 214
DdeI CTNAG 2 cut(s) 110, 251
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
Eco31I GGTCTC 1 cut(s) 307
Eco47I GGWCC 1 cut(s) 255
Eco57I CTGAAG 2 cut(s) 419, 524
EcoO109I RGGNCCY 1 cut(s) 255
FaiI YATR 8 cut(s) 68, 75, 138, 149, 327, 356, 470, 548
FaqI GGGAC 3 cut(s) 147, 241, 496
Fnu4HI GCNGC 6 cut(s) 15, 115, 118, 275, 278, 392
Fsp4HI GCNGC 6 cut(s) 15, 115, 118, 275, 278, 392
FspBI CTAG 2 cut(s) 405, 428
GluI GCNGC 6 cut(s) 15, 115, 118, 275, 278, 392
HaeIII GGCC 2 cut(s) 225, 394
HgaI GACGC 1 cut(s) 194
HincII GTYRAC 1 cut(s) 209
HindII GTYRAC 1 cut(s) 209
HindIII AAGCTT 1 cut(s) 184
HinfI GANTC 2 cut(s) 509, 518
Hpy166II GTNNAC 2 cut(s) 209, 452
Hpy188I TCNGA 3 cut(s) 381, 438, 504
Hpy188III TCNNGA 4 cut(s) 25, 109, 361, 428
Hpy8I GTNNAC 2 cut(s) 209, 452
Hpy99I CGWCG 1 cut(s) 450
HpyAV CCTTC 3 cut(s) 124, 238, 499
HpyCH4III ACNGT 3 cut(s) 62, 175, 213
HpyCH4IV ACGT 1 cut(s) 448
HpyCH4V TGCA 6 cut(s) 90, 274, 280, 329, 370, 539
HpyF3I CTNAG 2 cut(s) 110, 251
HpySE526I ACGT 1 cut(s) 448
Kzo9I GATC 1 cut(s) 93
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 5 cut(s) 122, 182, 386, 479, 519
Lsp1109I GCAGC 3 cut(s) 26, 264, 286
LweI GCATC 2 cut(s) 379, 548
MaeI CTAG 2 cut(s) 405, 428
MaeII ACGT 1 cut(s) 448
MalI GATC 1 cut(s) 95
MbiI CCGCTC 1 cut(s) 106
MboI GATC 1 cut(s) 93
MboII GAAGA 4 cut(s) 203, 353, 368, 497
MfeI CAATTG 1 cut(s) 125
MflI RGATCY 1 cut(s) 93
MluCI AATT 4 cut(s) 125, 156, 269, 417
MlyI GAGTC 1 cut(s) 518
MmeI TCCRAC 1 cut(s) 504
MnlI CCTC 6 cut(s) 62, 246, 457, 468, 471, 520
MseI TTAA 3 cut(s) 240, 261, 441
MspA1I CMGCKG 1 cut(s) 277
MunI CAATTG 1 cut(s) 125
NdeII GATC 1 cut(s) 93
NlaIV GGNNCC 2 cut(s) 257, 395
PfeI GAWTC 1 cut(s) 518
PkrI GCNGC 6 cut(s) 16, 116, 119, 276, 279, 393
PleI GAGTC 1 cut(s) 517
PpsI GAGTC 1 cut(s) 517
PpuMI RGGWCCY 1 cut(s) 255
PsiI TTATAA 1 cut(s) 68
Psp5II RGGWCCY 1 cut(s) 255
PspN4I GGNNCC 2 cut(s) 257, 395
PspPI GGNCC 3 cut(s) 224, 255, 393
PspPPI RGGWCCY 1 cut(s) 255
PsuI RGATCY 1 cut(s) 93
PvuII CAGCTG 1 cut(s) 277
RsaI GTAC 1 cut(s) 215
RsaNI GTAC 1 cut(s) 214
SaqAI TTAA 3 cut(s) 240, 261, 441
SatI GCNGC 6 cut(s) 15, 115, 118, 275, 278, 392
Sau3AI GATC 1 cut(s) 93
Sau96I GGNCC 3 cut(s) 224, 255, 393
SchI GAGTC 1 cut(s) 518
SfaNI GCATC 2 cut(s) 379, 548
SfcI CTRYAG 1 cut(s) 35
SinI GGWCC 1 cut(s) 255
Sse9I AATT 4 cut(s) 125, 156, 269, 417
SsiI CCGC 4 cut(s) 104, 115, 118, 391
SspI AATATT 1 cut(s) 232
SspMI CTAG 2 cut(s) 405, 428
TaaI ACNGT 3 cut(s) 62, 175, 213
TaiI ACGT 1 cut(s) 451
TasI AATT 4 cut(s) 125, 156, 269, 417
TauI GCSGC 3 cut(s) 117, 120, 394
TfiI GAWTC 1 cut(s) 518
Tru1I TTAA 3 cut(s) 240, 261, 441
Tru9I TTAA 3 cut(s) 240, 261, 441
TscAI CASTG 1 cut(s) 538
TseI GCWGC 3 cut(s) 14, 274, 277
TspRI CASTG 1 cut(s) 538
VpaK11BI GGWCC 1 cut(s) 255
XbaI TCTAGA 1 cut(s) 427
XspI CTAG 2 cut(s) 405, 428
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.