Rw4G011220

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Forward (+)
26588171 .. 26590607
2437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G011220.1

Sequence Viewer

Length: 528 bp
ATGGCTACAGCGACCTACCCACCTCCACCACCGTATTATAAGCTATACAAAGATTACTTGCAAGATCCCAAATCCGCTCCTGAGCCGCCGCCACCAATTGAAGGGACATACATTTGCTATGGTGCTAATTACACCACAGATGACGTGCTTCCAAGCTTGGAAGAACAGGGAGTGCGTCAACTGTACCCAAAAGGCCCAAATATTGATTTTAAGAAGGAACTGAGGTCCCTTAACAGAGAATTGCAGCTGCACATTTTGGAACTTGCTGATATTCTCGTGGAGAGACCATCACAATATGCAAGGAGAGTGGAAGAAATATCTCTTATATTCAAGAACTTGCAGCATCTTCTGAACTCATTGCGGCCCCATCAGGCTAGGGCAACACTAATTCACATTCTAGAACTTCAGATTAAACGACGTAAACAAGCTGTTGAGGATATAAAGAGGAGGAGAGAAGAAGCACAGGCACTTCTGAAGGAGTCCCTTGAATCGTTGGAGGACACTGGTGCATCTCTTATGTTGAAATAG

Protein Analysis

175

Amino Acids

20.26

Weight (kDa)

6.92

Isoelectric Point (pI)

80.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 4 - 158 1.5e-44 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 39
AccBSI CCGCTC 1 cut(s) 77
AciI CCGC 4 cut(s) 75, 86, 89, 361
AclWI GGATC 1 cut(s) 59
AcuI CTGAAG 2 cut(s) 389, 494
AfaI GTAC 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 4 cut(s) 101, 331, 488, 523
AjiI CACGTC 1 cut(s) 145
AluBI AGCT 4 cut(s) 43, 156, 247, 428
AluI AGCT 4 cut(s) 43, 156, 247, 428
Alw26I GTCTC 1 cut(s) 277
AlwI GGATC 1 cut(s) 59
AoxI GGCC 2 cut(s) 193, 362
ApeKI GCWGC 3 cut(s) 244, 247, 340
AspS9I GGNCC 3 cut(s) 194, 225, 363
AvaII GGWCC 1 cut(s) 225
BauI CACGAG 1 cut(s) 275
BbvI GCAGC 3 cut(s) 234, 256, 352
BccI CCATC 2 cut(s) 295, 375
BcoDI GTCTC 1 cut(s) 277
BfaI CTAG 2 cut(s) 375, 398
BfmI CTRYAG 1 cut(s) 6
BisI GCNGC 6 cut(s) 86, 89, 245, 248, 341, 362
BlsI GCNGC 6 cut(s) 87, 90, 246, 249, 342, 363
Bme18I GGWCC 1 cut(s) 225
BmgBI CACGTC 1 cut(s) 145
BmgT120I GGNCC 3 cut(s) 194, 225, 363
BmiI GGNNCC 2 cut(s) 227, 365
BmsI GCATC 2 cut(s) 352, 518
Bpu10I CCTNAGC 1 cut(s) 81
BsaI GGTCTC 1 cut(s) 277
Bsc4I CCNNNNNNNGG 1 cut(s) 101
Bse1I ACTGG 1 cut(s) 508
Bse3DI GCAATG 1 cut(s) 356
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMI GCAATG 1 cut(s) 356
BseMII CTCAG 2 cut(s) 72, 212
BseNI ACTGG 1 cut(s) 508
BseRI GAGGAG 2 cut(s) 460, 463
BseXI GCAGC 3 cut(s) 234, 256, 352
BsgI GTGCAG 1 cut(s) 233
BshFI GGCC 2 cut(s) 195, 364
BslFI GGGAC 3 cut(s) 118, 211, 466
BslI CCNNNNNNNGG 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 277
BsmFI GGGAC 3 cut(s) 118, 211, 466
BsnI GGCC 2 cut(s) 195, 364
Bso31I GGTCTC 1 cut(s) 277
Bsp143I GATC 1 cut(s) 64
BspACI CCGC 4 cut(s) 75, 86, 89, 361
BspANI GGCC 2 cut(s) 195, 364
BspCNI CTCAG 2 cut(s) 73, 213
BspLI GGNNCC 2 cut(s) 227, 365
BspPI GGATC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 277
BsrBI CCGCTC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 356
BsrI ACTGG 1 cut(s) 508
BssMI GATC 1 cut(s) 64
BssSI CACGAG 1 cut(s) 275
Bst2BI CACGAG 1 cut(s) 275
Bst4CI ACNGT 2 cut(s) 33, 183
BstDEI CTNAG 2 cut(s) 81, 221
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 277
BstMBI GATC 1 cut(s) 64
BstSFI CTRYAG 1 cut(s) 6
BstV1I GCAGC 3 cut(s) 234, 256, 352
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BsuRI GGCC 2 cut(s) 195, 364
BtrI CACGTC 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 501
Cfr13I GGNCC 3 cut(s) 194, 225, 363
CseI GACGC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 184
CspCI CAANNNNNGTGG 2 cut(s) 288, 323
CviJI RGCY 9 cut(s) 5, 43, 85, 156, 195, 247, 364, 374, 428
CviKI_1 RGCY 9 cut(s) 5, 43, 85, 156, 195, 247, 364, 374, 428
CviQI GTAC 1 cut(s) 184
DdeI CTNAG 2 cut(s) 81, 221
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eco31I GGTCTC 1 cut(s) 277
Eco47I GGWCC 1 cut(s) 225
Eco57I CTGAAG 2 cut(s) 389, 494
EcoO109I RGGNCCY 1 cut(s) 225
FaiI YATR 8 cut(s) 39, 46, 109, 120, 297, 326, 440, 518
FaqI GGGAC 3 cut(s) 118, 211, 466
Fnu4HI GCNGC 6 cut(s) 86, 89, 245, 248, 341, 362
Fsp4HI GCNGC 6 cut(s) 86, 89, 245, 248, 341, 362
FspBI CTAG 2 cut(s) 375, 398
GluI GCNGC 6 cut(s) 86, 89, 245, 248, 341, 362
HaeIII GGCC 2 cut(s) 195, 364
HgaI GACGC 1 cut(s) 164
HincII GTYRAC 1 cut(s) 179
HindII GTYRAC 1 cut(s) 179
HindIII AAGCTT 1 cut(s) 154
HinfI GANTC 2 cut(s) 479, 488
Hpy166II GTNNAC 2 cut(s) 179, 422
Hpy188I TCNGA 3 cut(s) 351, 408, 474
Hpy188III TCNNGA 3 cut(s) 80, 331, 398
Hpy8I GTNNAC 2 cut(s) 179, 422
Hpy99I CGWCG 1 cut(s) 420
HpyAV CCTTC 3 cut(s) 95, 208, 469
HpyCH4III ACNGT 2 cut(s) 33, 183
HpyCH4IV ACGT 2 cut(s) 144, 418
HpyCH4V TGCA 6 cut(s) 61, 244, 250, 299, 340, 509
HpyF3I CTNAG 2 cut(s) 81, 221
HpySE526I ACGT 2 cut(s) 144, 418
Kzo9I GATC 1 cut(s) 64
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 5 cut(s) 93, 152, 356, 449, 489
Lsp1109I GCAGC 3 cut(s) 234, 256, 352
LweI GCATC 2 cut(s) 352, 518
MaeI CTAG 2 cut(s) 375, 398
MaeII ACGT 2 cut(s) 144, 418
MalI GATC 1 cut(s) 66
MbiI CCGCTC 1 cut(s) 77
MboI GATC 1 cut(s) 64
MboII GAAGA 4 cut(s) 173, 323, 338, 467
MfeI CAATTG 1 cut(s) 96
MflI RGATCY 1 cut(s) 64
MluCI AATT 4 cut(s) 96, 127, 239, 387
MlyI GAGTC 1 cut(s) 488
MmeI TCCRAC 1 cut(s) 474
MnlI CCTC 6 cut(s) 33, 216, 427, 438, 441, 490
MseI TTAA 3 cut(s) 210, 231, 411
MspA1I CMGCKG 1 cut(s) 247
MunI CAATTG 1 cut(s) 96
NdeII GATC 1 cut(s) 64
NlaIV GGNNCC 2 cut(s) 227, 365
PfeI GAWTC 1 cut(s) 488
PkrI GCNGC 6 cut(s) 87, 90, 246, 249, 342, 363
PleI GAGTC 1 cut(s) 487
PpsI GAGTC 1 cut(s) 487
PpuMI RGGWCCY 1 cut(s) 225
PsiI TTATAA 1 cut(s) 39
Psp5II RGGWCCY 1 cut(s) 225
PspN4I GGNNCC 2 cut(s) 227, 365
PspPI GGNCC 3 cut(s) 194, 225, 363
PspPPI RGGWCCY 1 cut(s) 225
PsuI RGATCY 1 cut(s) 64
PvuII CAGCTG 1 cut(s) 247
RsaI GTAC 1 cut(s) 185
RsaNI GTAC 1 cut(s) 184
SaqAI TTAA 3 cut(s) 210, 231, 411
SatI GCNGC 6 cut(s) 86, 89, 245, 248, 341, 362
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 3 cut(s) 194, 225, 363
SchI GAGTC 1 cut(s) 488
SetI ASST 9 cut(s) 17, 25, 45, 147, 158, 227, 249, 421, 430
SfaNI GCATC 2 cut(s) 352, 518
SfcI CTRYAG 1 cut(s) 6
SinI GGWCC 1 cut(s) 225
Sse9I AATT 4 cut(s) 96, 127, 239, 387
SsiI CCGC 4 cut(s) 75, 86, 89, 361
SspI AATATT 1 cut(s) 202
SspMI CTAG 2 cut(s) 375, 398
TaaI ACNGT 2 cut(s) 33, 183
TaiI ACGT 2 cut(s) 147, 421
TasI AATT 4 cut(s) 96, 127, 239, 387
TauI GCSGC 3 cut(s) 88, 91, 364
TfiI GAWTC 1 cut(s) 488
Tru1I TTAA 3 cut(s) 210, 231, 411
Tru9I TTAA 3 cut(s) 210, 231, 411
TscAI CASTG 1 cut(s) 508
TseI GCWGC 3 cut(s) 244, 247, 340
TspRI CASTG 1 cut(s) 508
VpaK11BI GGWCC 1 cut(s) 225
XbaI TCTAGA 1 cut(s) 397
XspI CTAG 2 cut(s) 375, 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.