Rmu_sc0008926.1_g000002

Enoyl-(Acyl carrier protein) reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008926.1
Physical Location & Seq
Reverse (-)
5283 .. 5739
457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008926.1_g000002.1.cds

Sequence Viewer

Length: 369 bp
atgcactactatgaggattctgattttgatgaaagcgaaaacagagaactaatagggattgaagttttgaacaggaaaaatgttgcctttaatagagctttggtttctccaatctgcttcaagatgggatattcattccagagtgcaagacttgaaggcaaggtggctctaattactggagcagcaagtggcctaggaaaggcaactgcatcaaaattcatcagcaatggtgccaaggttgttcttgcagatatcgaacaccagcttgggcaagacgcggcaaaggagcttggtcctaatgccagcttcattgcctgtgatgtcacaaaagaatccgacatttccaatgctgtgatttcacatctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.14

Weight (kDa)

5.29

Isoelectric Point (pI)

40.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 230
AccII CGCG 1 cut(s) 278
AciI CCGC 1 cut(s) 278
AcsI RAATTY 1 cut(s) 215
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 4 cut(s) 62, 70, 121, 155
AjuI GAANNNNNNNTTGG 2 cut(s) 249, 281
AluBI AGCT 4 cut(s) 98, 265, 289, 306
AluI AGCT 4 cut(s) 98, 265, 289, 306
AoxI GGCC 1 cut(s) 190
ApeKI GCWGC 1 cut(s) 182
ApoI RAATTY 1 cut(s) 215
AspA2I CCTAGG 1 cut(s) 193
AspS9I GGNCC 1 cut(s) 293
AvaII GGWCC 1 cut(s) 293
AvrII CCTAGG 1 cut(s) 193
BanI GGYRCC 1 cut(s) 230
BbvI GCAGC 1 cut(s) 194
BccI CCATC 1 cut(s) 118
BfaI CTAG 1 cut(s) 194
BisI GCNGC 2 cut(s) 183, 279
BlnI CCTAGG 1 cut(s) 193
BlsI GCNGC 2 cut(s) 184, 280
Bme18I GGWCC 1 cut(s) 293
BmgT120I GGNCC 1 cut(s) 293
BmiI GGNNCC 1 cut(s) 232
BmsI GCATC 1 cut(s) 218
BpmI CTGGAG 1 cut(s) 198
BsaJI CCNNGG 2 cut(s) 193, 234
Bsc4I CCNNNNNNNGG 1 cut(s) 199
Bse1I ACTGG 1 cut(s) 181
Bse3DI GCAATG 2 cut(s) 232, 309
BseDI CCNNGG 2 cut(s) 193, 234
BseLI CCNNNNNNNGG 1 cut(s) 199
BseMI GCAATG 2 cut(s) 232, 309
BseNI ACTGG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 194
Bsh1236I CGCG 1 cut(s) 278
BshFI GGCC 1 cut(s) 192
BshNI GGYRCC 1 cut(s) 230
BslI CCNNNNNNNGG 1 cut(s) 199
BsnI GGCC 1 cut(s) 192
BspACI CCGC 1 cut(s) 278
BspANI GGCC 1 cut(s) 192
BspFNI CGCG 1 cut(s) 278
BspLI GGNNCC 1 cut(s) 232
BspT107I GGYRCC 1 cut(s) 230
BsrDI GCAATG 2 cut(s) 232, 309
BsrI ACTGG 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 193, 234
BssT1I CCWWGG 2 cut(s) 193, 234
BstC8I GCNNGC 1 cut(s) 304
BstENI CCTNNNNNAGG 1 cut(s) 197
BstFNI CGCG 1 cut(s) 278
BstUI CGCG 1 cut(s) 278
BstV1I GCAGC 1 cut(s) 194
BsuRI GGCC 1 cut(s) 192
Cac8I GCNNGC 1 cut(s) 304
Cfr13I GGNCC 1 cut(s) 293
CseI GACGC 1 cut(s) 284
CviJI RGCY 6 cut(s) 98, 167, 192, 265, 289, 306
CviKI_1 RGCY 6 cut(s) 98, 167, 192, 265, 289, 306
Eco130I CCWWGG 2 cut(s) 193, 234
Eco32I GATATC 1 cut(s) 253
Eco47I GGWCC 1 cut(s) 293
EcoNI CCTNNNNNAGG 1 cut(s) 197
EcoRV GATATC 1 cut(s) 253
EcoT14I CCWWGG 2 cut(s) 193, 234
ErhI CCWWGG 2 cut(s) 193, 234
FaiI YATR 1 cut(s) 12
Fnu4HI GCNGC 2 cut(s) 183, 279
Fsp4HI GCNGC 2 cut(s) 183, 279
FspBI CTAG 1 cut(s) 194
GluI GCNGC 2 cut(s) 183, 279
GsuI CTGGAG 1 cut(s) 198
HaeIII GGCC 1 cut(s) 192
HgaI GACGC 1 cut(s) 284
HinfI GANTC 2 cut(s) 17, 332
Hpy188I TCNGA 2 cut(s) 22, 337
Hpy188III TCNNGA 2 cut(s) 121, 139
HpyAV CCTTC 1 cut(s) 149
HpyCH4V TGCA 4 cut(s) 4, 146, 209, 248
LmnI GCTCC 2 cut(s) 179, 286
LpnPI CCDG 6 cut(s) 58, 152, 162, 275, 316, 328
Lsp1109I GCAGC 1 cut(s) 194
LweI GCATC 1 cut(s) 218
MaeI CTAG 1 cut(s) 194
MaeIII GTNAC 1 cut(s) 322
MluCI AATT 2 cut(s) 171, 215
MmeI TCCRAC 1 cut(s) 360
MnlI CCTC 1 cut(s) 7
MseI TTAA 1 cut(s) 90
MslI CAYNNNNRTG 1 cut(s) 9
MvnI CGCG 1 cut(s) 278
NlaIV GGNNCC 1 cut(s) 232
NmuCI GTSAC 1 cut(s) 322
PfeI GAWTC 2 cut(s) 17, 332
PkrI GCNGC 2 cut(s) 184, 280
PspN4I GGNNCC 1 cut(s) 232
PspPI GGNCC 1 cut(s) 293
RseI CAYNNNNRTG 1 cut(s) 9
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 2 cut(s) 183, 279
Sau96I GGNCC 1 cut(s) 293
SetI ASST 6 cut(s) 100, 165, 240, 267, 291, 308
SfaNI GCATC 1 cut(s) 218
SinI GGWCC 1 cut(s) 293
SmiMI CAYNNNNRTG 1 cut(s) 9
Sse9I AATT 2 cut(s) 171, 215
SsiI CCGC 1 cut(s) 278
SspMI CTAG 1 cut(s) 194
StyI CCWWGG 2 cut(s) 193, 234
TaqI TCGA 1 cut(s) 255
TasI AATT 2 cut(s) 171, 215
TauI GCSGC 1 cut(s) 281
TfiI GAWTC 2 cut(s) 17, 332
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TseFI GTSAC 1 cut(s) 322
TseI GCWGC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 322
TspDTI ATGAA 4 cut(s) 45, 123, 208, 298
VpaK11BI GGWCC 1 cut(s) 293
XagI CCTNNNNNAGG 1 cut(s) 197
XapI RAATTY 1 cut(s) 215
XmaJI CCTAGG 1 cut(s) 193
XspI CTAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.