Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000060.1

Orthogroup ID

OG0004022

Physical Location & Seq

Genomic Coordinates Forward (+)

158 .. 1117

Gene Structure 960 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000060.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 864 bp

atgttacctttacaagagctttggtttctccaagctgcttcaggctggggtattcatcccagagcggaaggaaaggtggcactgattacaggagcagcaagtggtataggaaaggcaactgcatcaaaattcatcagcaatggagccaaggttgttcttgcagatatccaacaccagcttggccaagacgcagcaaaggagcttggtcctaatgccagcttcattgcctgtgatgtcacaaaagaatccgacatttccaatgctgtagatttcaccatctctaagcacagccagcttgatattatgcacagcaatgcaggtgtagcttgtaaatctcctccaagcattgtggaccttgacatggcagtgtttgatcgtgtcatgaacatcaacgtgcgaggagtcctggcaggaattaagcacgcttcacgtgtgatgatcccccgcaaaactggctcaattctctgcacagccagcgtcacaggactaatgggaggactagcacagcacacctattctctgtccaagtttgctgtaataggcattgtcaagtctctagctgcagagctacgccagcatgggatccgggtcaattgcatatccccattcgccattccaaccccatttgttatcgaagaaatgagtcagatttatccaggagctgatgaagagaagttaattgaaattatacatcgctctggggccttagaaggagcaaactgtgaacccaatgacattgccaatgctgcactttacctagcttcagatgatgctaaatatgttagtggccataatttggttgtagatggaggttttacatctttcaagacttttagtttccctgcaccagatcaggtgctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

adh_short_C2

Protein Analysis

287

Amino Acids

30.38

Weight (kDa)

6.13

Isoelectric Point (pI)

36.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004022)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G26760 AT4G03140
fragaria_vesca	FvH4_2g24720 FvH4_2g24720 FvH4_2g24720 FvH4_2g24720
malus_domestica	MD00G1056500.v1.1 MD11G1297800.v1.1
prunus_persica	Prupe.8G252100_v2.0.a1 Prupe.8G252100_v2.0.a1
pyrus_communis	pycom11g26150
rosa_chinensis	RchiOBHm_Chr5g0073011 RchiOBHm_Chr5g0073031
rosa_laevigata	RLG00000012012 RLG00000036354
rosa_multiflora	Rmu_sc0008926.1_g000002 Rmu_sc0010900.1_g000001 Rmu_ssc0000060.1_g000001
rosa_roxburghii	Rroxscaffold_1G00008180 Rroxscaffold_1G00008190 Rroxscaffold_1G00008260 Rroxscaffold_7G00174960
rosa_rugosa	Rorug05G0420600 Rorug06G0227600 Rorug06G0227700
rosa_samantha	Rh5BG498000 Rh5CG521800 Rh6AG340800 Rh6BG348400 Rh6CG355100 Rh6DG340900
rosa_wichuraiana	Rw5G044350 Rw6G029690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	308
Acc36I	ACCTGC	1 cut(s)	308
AccB7I	CCANNNNNTGG	1 cut(s)	796
AccBSI	CCGCTC	1 cut(s)	65
AciI	CCGC	2 cut(s)	65, 445
AclWI	GGATC	3 cut(s)	433, 577, 590
AcoI	YGGCCR	2 cut(s)	181, 787
AcsI	RAATTY	1 cut(s)	128
AcuI	CTGAAG	2 cut(s)	24, 747
AcvI	CACGTG	1 cut(s)	431
AfiI	CCNNNNNNNGG	2 cut(s)	361, 796
AflIII	ACRYGT	1 cut(s)	430
AgsI	TTSAA	2 cut(s)	683, 826
AjnI	CCWGG	2 cut(s)	405, 655
Alw26I	GTCTC	1 cut(s)	558
AlwI	GGATC	3 cut(s)	433, 577, 590
AlwNI	CAGNNNCTG	1 cut(s)	662
AoxI	GGCC	3 cut(s)	181, 702, 787
ApeKI	GCWGC	5 cut(s)	35, 95, 191, 560, 746
ApoI	RAATTY	1 cut(s)	128
AspS9I	GGNCC	3 cut(s)	206, 352, 702
AsuC2I	CCSGG	1 cut(s)	587
AsuHPI	GGTGA	1 cut(s)	265
AvaII	GGWCC	2 cut(s)	206, 352
BalI	TGGCCA	2 cut(s)	183, 789
BamHI	GGATCC	1 cut(s)	582
BbrPI	CACGTG	1 cut(s)	431
BbvI	GCAGC	5 cut(s)	22, 107, 203, 547, 733
BccI	CCATC	2 cut(s)	284, 800
BciT130I	CCWGG	2 cut(s)	407, 657
BcnI	CCSGG	1 cut(s)	587
BcoDI	GTCTC	1 cut(s)	558
BfaI	CTAG	3 cut(s)	500, 557, 758
BfmI	CTRYAG	2 cut(s)	264, 561
BfuAI	ACCTGC	1 cut(s)	308
BisI	GCNGC	5 cut(s)	36, 96, 192, 561, 747
BlsI	GCNGC	5 cut(s)	37, 97, 193, 562, 748
Bme1390I	CCNGG	3 cut(s)	407, 587, 657
Bme18I	GGWCC	2 cut(s)	206, 352
BmgT120I	GGNCC	3 cut(s)	206, 352, 702
BmiI	GGNNCC	3 cut(s)	145, 584, 703
BmrFI	CCNGG	3 cut(s)	407, 587, 657
BmsI	GCATC	2 cut(s)	131, 760
BpuMI	CCSGG	1 cut(s)	587
BsaAI	YACGTR	1 cut(s)	431
BsaJI	CCNNGG	1 cut(s)	147
BsaXI	ACNNNNNCTCC	2 cut(s)	135, 165
Bsc4I	CCNNNNNNNGG	2 cut(s)	361, 796
Bse1I	ACTGG	1 cut(s)	457
Bse3DI	GCAATG	4 cut(s)	145, 222, 319, 735
BseBI	CCWGG	2 cut(s)	407, 657
BseDI	CCNNGG	1 cut(s)	147
BseGI	GGATG	1 cut(s)	55
BseLI	CCNNNNNNNGG	2 cut(s)	361, 796
BseMI	GCAATG	4 cut(s)	145, 222, 319, 735
BseNI	ACTGG	1 cut(s)	457
BseRI	GAGGAG	2 cut(s)	327, 414
BseXI	GCAGC	5 cut(s)	22, 107, 203, 547, 733
BseYI	CCCAGC	1 cut(s)	45
BsgI	GTGCAG	3 cut(s)	451, 732, 828
BshFI	GGCC	3 cut(s)	183, 704, 789
BsiSI	CCGG	1 cut(s)	586
BslI	CCNNNNNNNGG	2 cut(s)	361, 796
BsmAI	GTCTC	1 cut(s)	558
BsnI	GGCC	3 cut(s)	183, 704, 789
Bsp143I	GATC	4 cut(s)	373, 438, 582, 850
BspACI	CCGC	2 cut(s)	65, 445
BspANI	GGCC	3 cut(s)	183, 704, 789
BspHI	TCATGA	1 cut(s)	381
BspLI	GGNNCC	3 cut(s)	145, 584, 703
BspMAI	CTGCAG	1 cut(s)	565
BspMI	ACCTGC	1 cut(s)	308
BspPI	GGATC	3 cut(s)	433, 577, 590
BsrBI	CCGCTC	1 cut(s)	65
BsrDI	GCAATG	4 cut(s)	145, 222, 319, 735
BsrI	ACTGG	1 cut(s)	457
BssECI	CCNNGG	1 cut(s)	147
BssMI	GATC	4 cut(s)	373, 438, 582, 850
BssT1I	CCWWGG	1 cut(s)	147
Bst2UI	CCWGG	2 cut(s)	407, 657
Bst4CI	ACNGT	1 cut(s)	722
Bst6I	CTCTTC	1 cut(s)	663
BstBAI	YACGTR	1 cut(s)	431
BstC8I	GCNNGC	5 cut(s)	217, 293, 423, 475, 575
BstDEI	CTNAG	2 cut(s)	282, 706
BstF5I	GGATG	1 cut(s)	55
BstKTI	GATC	4 cut(s)	376, 441, 585, 853
BstMAI	GTCTC	1 cut(s)	558
BstMBI	GATC	4 cut(s)	373, 438, 582, 850
BstMWI	GCNNNNNNNGC	6 cut(s)	292, 323, 453, 474, 574, 746
BstNI	CCWGG	2 cut(s)	407, 657
BstSCI	CCNGG	3 cut(s)	405, 585, 655
BstSFI	CTRYAG	2 cut(s)	264, 561
BstV1I	GCAGC	5 cut(s)	22, 107, 203, 547, 733
BstX2I	RGATCY	1 cut(s)	582
BstYI	RGATCY	1 cut(s)	582
BsuRI	GGCC	3 cut(s)	183, 704, 789
BtgZI	GCGATG	1 cut(s)	677
BtsCI	GGATG	1 cut(s)	55
BtsI	GCAGTG	1 cut(s)	372
BtsIMutI	CAGTG	2 cut(s)	80, 372
BveI	ACCTGC	1 cut(s)	308
Cac8I	GCNNGC	5 cut(s)	217, 293, 423, 475, 575
CaiI	CAGNNNCTG	1 cut(s)	662
CciI	TCATGA	1 cut(s)	381
Cfr13I	GGNCC	3 cut(s)	206, 352, 702
CseI	GACGC	2 cut(s)	197, 466
CspCI	CAANNNNNGTGG	2 cut(s)	330, 365
CviAII	CATG	3 cut(s)	361, 382, 578
DdeI	CTNAG	2 cut(s)	282, 706
DpnI	GATC	4 cut(s)	375, 440, 584, 852
DpnII	GATC	4 cut(s)	373, 438, 582, 850
EaeI	YGGCCR	2 cut(s)	181, 787
Eam1104I	CTCTTC	1 cut(s)	663
EarI	CTCTTC	1 cut(s)	663
Eco130I	CCWWGG	1 cut(s)	147
Eco32I	GATATC	1 cut(s)	166
Eco47I	GGWCC	2 cut(s)	206, 352
Eco57I	CTGAAG	2 cut(s)	24, 747
Eco72I	CACGTG	1 cut(s)	431
EcoO109I	RGGNCCY	1 cut(s)	702
EcoRII	CCWGG	2 cut(s)	405, 655
EcoRV	GATATC	1 cut(s)	166
EcoT14I	CCWWGG	1 cut(s)	147
ErhI	CCWWGG	1 cut(s)	147
FaeI	CATG	3 cut(s)	364, 385, 581
FaiI	YATR	9 cut(s)	107, 305, 362, 383, 579, 599, 689, 780, 792
FatI	CATG	3 cut(s)	360, 381, 577
FauI	CCCGC	1 cut(s)	452
Fnu4HI	GCNGC	5 cut(s)	36, 96, 192, 561, 747
FokI	GGATG	1 cut(s)	42
Fsp4HI	GCNGC	5 cut(s)	36, 96, 192, 561, 747
FspBI	CTAG	3 cut(s)	500, 557, 758
GluI	GCNGC	5 cut(s)	36, 96, 192, 561, 747
GsaI	CCCAGC	1 cut(s)	49
HaeIII	GGCC	3 cut(s)	183, 704, 789
HapII	CCGG	1 cut(s)	586
HgaI	GACGC	2 cut(s)	197, 466
Hin1II	CATG	3 cut(s)	364, 385, 581
HinfI	GANTC	3 cut(s)	245, 402, 643
HpaII	CCGG	1 cut(s)	586
HphI	GGTGA	1 cut(s)	265
Hpy166II	GTNNAC	2 cut(s)	352, 725
Hpy188I	TCNGA	3 cut(s)	250, 648, 766
Hpy188III	TCNNGA	2 cut(s)	382, 826
Hpy8I	GTNNAC	2 cut(s)	352, 725
HpyAV	CCTTC	2 cut(s)	62, 704
HpyCH4III	ACNGT	1 cut(s)	722
HpyCH4IV	ACGT	2 cut(s)	393, 430
HpyCH4V	TGCA	9 cut(s)	122, 161, 307, 317, 468, 563, 597, 749, 845
HpyF10VI	GCNNNNNNNGC	6 cut(s)	292, 323, 453, 474, 574, 746
HpyF3I	CTNAG	2 cut(s)	282, 706
HpySE526I	ACGT	2 cut(s)	393, 430
Hsp92II	CATG	3 cut(s)	364, 385, 581
Kzo9I	GATC	4 cut(s)	373, 438, 582, 850
LmnI	GCTCC	5 cut(s)	92, 143, 199, 659, 713
Lsp1109I	GCAGC	5 cut(s)	22, 107, 203, 547, 733
LweI	GCATC	2 cut(s)	131, 760
MaeI	CTAG	3 cut(s)	500, 557, 758
MaeII	ACGT	2 cut(s)	393, 430
MaeIII	GTNAC	3 cut(s)	3, 235, 478
MalI	GATC	4 cut(s)	375, 440, 584, 852
MbiI	CCGCTC	1 cut(s)	65
MboI	GATC	4 cut(s)	373, 438, 582, 850
MboII	GAAGA	2 cut(s)	647, 680
MfeI	CAATTG	1 cut(s)	592
MflI	RGATCY	1 cut(s)	582
MlsI	TGGCCA	2 cut(s)	183, 789
MluCI	AATT	7 cut(s)	128, 414, 459, 592, 678, 684, 793
MluNI	TGGCCA	2 cut(s)	183, 789
MlyI	GAGTC	2 cut(s)	411, 652
MmeI	TCCRAC	3 cut(s)	193, 273, 641
MnlI	CCTC	4 cut(s)	348, 392, 488, 803
Mox20I	TGGCCA	2 cut(s)	183, 789
MscI	TGGCCA	2 cut(s)	183, 789
MseI	TTAA	3 cut(s)	417, 677, 862
MslI	CAYNNNNRTG	3 cut(s)	312, 365, 392
Msp20I	TGGCCA	2 cut(s)	183, 789
MspI	CCGG	1 cut(s)	586
MspR9I	CCNGG	3 cut(s)	407, 587, 657
MunI	CAATTG	1 cut(s)	592
MvaI	CCWGG	2 cut(s)	407, 657
MwoI	GCNNNNNNNGC	6 cut(s)	292, 323, 453, 474, 574, 746
NciI	CCSGG	1 cut(s)	587
NdeII	GATC	4 cut(s)	373, 438, 582, 850
NlaIII	CATG	3 cut(s)	364, 385, 581
NlaIV	GGNNCC	3 cut(s)	145, 584, 703
NmuCI	GTSAC	2 cut(s)	235, 478
PagI	TCATGA	1 cut(s)	381
PaqCI	CACCTGC	1 cut(s)	308
PfeI	GAWTC	1 cut(s)	245
PflMI	CCANNNNNTGG	1 cut(s)	796
PfoI	TCCNGGA	1 cut(s)	655
PkrI	GCNGC	5 cut(s)	37, 97, 193, 562, 748
PleI	GAGTC	2 cut(s)	410, 651
PmaCI	CACGTG	1 cut(s)	431
PmlI	CACGTG	1 cut(s)	431
PpsI	GAGTC	2 cut(s)	410, 651
Ppu21I	YACGTR	1 cut(s)	431
Psp6I	CCWGG	2 cut(s)	405, 655
PspCI	CACGTG	1 cut(s)	431
PspFI	CCCAGC	1 cut(s)	45
PspGI	CCWGG	2 cut(s)	405, 655
PspN4I	GGNNCC	3 cut(s)	145, 584, 703
PspPI	GGNCC	3 cut(s)	206, 352, 702
PstI	CTGCAG	1 cut(s)	565
PstNI	CAGNNNCTG	1 cut(s)	662
PsuI	RGATCY	1 cut(s)	582
RseI	CAYNNNNRTG	3 cut(s)	312, 365, 392
SaqAI	TTAA	3 cut(s)	417, 677, 862
SatI	GCNGC	5 cut(s)	36, 96, 192, 561, 747
Sau3AI	GATC	4 cut(s)	373, 438, 582, 850
Sau96I	GGNCC	3 cut(s)	206, 352, 702
SchI	GAGTC	2 cut(s)	411, 652
ScrFI	CCNGG	3 cut(s)	407, 587, 657
SfaNI	GCATC	2 cut(s)	131, 760
SfcI	CTRYAG	2 cut(s)	264, 561
SinI	GGWCC	2 cut(s)	206, 352
SmiMI	CAYNNNNRTG	3 cut(s)	312, 365, 392
Sse9I	AATT	7 cut(s)	128, 414, 459, 592, 678, 684, 793
SsiI	CCGC	2 cut(s)	65, 445
SspMI	CTAG	3 cut(s)	500, 557, 758
StyD4I	CCNGG	3 cut(s)	405, 585, 655
StyI	CCWWGG	1 cut(s)	147
TaaI	ACNGT	1 cut(s)	722
TaiI	ACGT	2 cut(s)	396, 433
TaqI	TCGA	1 cut(s)	633
TasI	AATT	7 cut(s)	128, 414, 459, 592, 678, 684, 793
TfiI	GAWTC	1 cut(s)	245
Tru1I	TTAA	3 cut(s)	417, 677, 862
Tru9I	TTAA	3 cut(s)	417, 677, 862
TscAI	CASTG	2 cut(s)	87, 372
TseFI	GTSAC	2 cut(s)	235, 478
TseI	GCWGC	5 cut(s)	35, 95, 191, 560, 746
Tsp45I	GTSAC	2 cut(s)	235, 478
TspDTI	ATGAA	5 cut(s)	44, 121, 211, 398, 681
TspRI	CASTG	2 cut(s)	87, 372
Van91I	CCANNNNNTGG	1 cut(s)	796
VpaK11BI	GGWCC	2 cut(s)	206, 352
XapI	RAATTY	1 cut(s)	128
XcmI	CCANNNNNNNNNTGG	1 cut(s)	176
XspI	CTAG	3 cut(s)	500, 557, 758

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.