Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr6

Orthogroup ID

OG0004022

Physical Location & Seq

Genomic Coordinates Forward (+)

53737165 .. 53739995

Gene Structure 2831 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw6G029690.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 858 bp

ATGCACAAGACCGGACATCTCATTCGCATTGATGGCTATACTAGTTTCTTCTCTCTACTTGAAGGAAAGGTGGCACTGATTACAGGAGCAGCAAGTGGTATAGGAAAGGCAACTGCATCAAAATTCATCAGCAATGGAGCCAAGGTTGTTCTTGCAGATATCCAACACCAGCTTGGCCAAGACGCAGCAAAGGAGCTTGGTCCTAATGCCAGCTTCATTGCCTGTGATGTCACAAAAGAATCCGACATTTCCAATGCTGTAGATTTCACCATCTCTAAGCACAGCCAGCTTGATATTATGCACAGCAATGCAGGTGTAGCTTGTAAATCTCCTCCAAGCATTGTGGACCTTGACCTGGCAGTGTTTGATCGTGTCATGAACATCAACGTGCGAGGAGTCCTGGCAGGAATTAAGCACGCTTCACGTGTGATGATCCCCCGCAAAACTGGCTCAATTCTCTGCACAGCCAGCGTCACAGGACTAATGGGAGGACTAGCACAGCACACCTATTCTCTGTCCAAGTTTGCTGTAATAGGCATTGTCAAGTCTCTGGCTGCAGAGCTACGCCAGCATGGGATCCGGGTCAATTGCATATCCCCATTCGCCATTCCAACCCCATTTGTTATCGAAGAAATGAGTCAGATTTATCCAGGAGCTGATGAAGAGAAGTTAATTGAAATTATACATCGCTCTGGGGCCTTAGAAGGAGCAAACTGTGAACCCAATGACATTGCCAATGCTGCACTTTACCTAGCTTCAGATGATGCTAAATATGTTAGTGGCCATAATTTGGTTGTAGATGGAGGTTTTACATCTTTCAAGACTTTTAGTTTCCCTGCACCAGATCAGGTGCTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

adh_short_C2

Protein Analysis

285

Amino Acids

30.18

Weight (kDa)

6.35

Isoelectric Point (pI)

34.28

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
adh_short	PF00106	23 - 210	3.6e-50	short chain dehydrogenase
KR	PF08659	25 - 198	4.2e-09	KR domain
adh_short_C2	PF13561	29 - 271	1.5e-60	Enoyl-(Acyl carrier protein) reductase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004022)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G26760 AT4G03140
fragaria_vesca	FvH4_2g24720 FvH4_2g24720 FvH4_2g24720 FvH4_2g24720
malus_domestica	MD00G1056500.v1.1 MD11G1297800.v1.1
prunus_persica	Prupe.8G252100_v2.0.a1 Prupe.8G252100_v2.0.a1
pyrus_communis	pycom11g26150
rosa_chinensis	RchiOBHm_Chr5g0073011 RchiOBHm_Chr5g0073031
rosa_laevigata	RLG00000012012 RLG00000036354
rosa_multiflora	Rmu_sc0008926.1_g000002 Rmu_sc0010900.1_g000001 Rmu_ssc0000060.1_g000001
rosa_roxburghii	Rroxscaffold_1G00008180 Rroxscaffold_1G00008190 Rroxscaffold_1G00008260 Rroxscaffold_7G00174960
rosa_rugosa	Rorug05G0420600 Rorug06G0227600 Rorug06G0227700
rosa_samantha	Rh5BG498000 Rh5CG521800 Rh6AG340800 Rh6BG348400 Rh6CG355100 Rh6DG340900
rosa_wichuraiana	Rw5G044350 Rw6G029690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	302
Acc36I	ACCTGC	1 cut(s)	302
AccB7I	CCANNNNNTGG	1 cut(s)	790
AciI	CCGC	1 cut(s)	439
AclWI	GGATC	3 cut(s)	427, 571, 584
AcoI	YGGCCR	2 cut(s)	175, 781
AcsI	RAATTY	1 cut(s)	122
AcuI	CTGAAG	1 cut(s)	741
AcvI	CACGTG	1 cut(s)	425
AfiI	CCNNNNNNNGG	2 cut(s)	355, 790
AflIII	ACRYGT	1 cut(s)	424
AgsI	TTSAA	3 cut(s)	62, 677, 820
AhlI	ACTAGT	1 cut(s)	41
AjnI	CCWGG	3 cut(s)	354, 399, 649
AluBI	AGCT	8 cut(s)	172, 196, 213, 289, 320, 562, 656, 755
AluI	AGCT	8 cut(s)	172, 196, 213, 289, 320, 562, 656, 755
Alw26I	GTCTC	1 cut(s)	552
AlwI	GGATC	3 cut(s)	427, 571, 584
AlwNI	CAGNNNCTG	1 cut(s)	656
AoxI	GGCC	3 cut(s)	175, 696, 781
ApeKI	GCWGC	4 cut(s)	89, 185, 554, 740
ApoI	RAATTY	1 cut(s)	122
ArsI	GACNNNNNNTTYG	1 cut(s)	38
AspS9I	GGNCC	3 cut(s)	200, 346, 696
AsuC2I	CCSGG	1 cut(s)	581
AsuHPI	GGTGA	1 cut(s)	259
AvaII	GGWCC	2 cut(s)	200, 346
BalI	TGGCCA	2 cut(s)	177, 783
BamHI	GGATCC	1 cut(s)	576
BbrPI	CACGTG	1 cut(s)	425
BbvI	GCAGC	4 cut(s)	101, 197, 541, 727
BccI	CCATC	3 cut(s)	26, 278, 794
BciT130I	CCWGG	3 cut(s)	356, 401, 651
BcnI	CCSGG	1 cut(s)	581
BcoDI	GTCTC	1 cut(s)	552
BcuI	ACTAGT	1 cut(s)	41
BfaI	CTAG	3 cut(s)	42, 494, 752
BfmI	CTRYAG	2 cut(s)	258, 555
BfuAI	ACCTGC	1 cut(s)	302
BisI	GCNGC	4 cut(s)	90, 186, 555, 741
BlsI	GCNGC	4 cut(s)	91, 187, 556, 742
Bme1390I	CCNGG	4 cut(s)	356, 401, 581, 651
Bme18I	GGWCC	2 cut(s)	200, 346
BmgT120I	GGNCC	3 cut(s)	200, 346, 696
BmiI	GGNNCC	3 cut(s)	139, 578, 697
BmrFI	CCNGG	4 cut(s)	356, 401, 581, 651
BmsI	GCATC	2 cut(s)	125, 754
BpuMI	CCSGG	1 cut(s)	581
BsaAI	YACGTR	1 cut(s)	425
BsaJI	CCNNGG	1 cut(s)	141
BsaWI	WCCGGW	1 cut(s)	11
BsaXI	ACNNNNNCTCC	2 cut(s)	129, 159
Bsc4I	CCNNNNNNNGG	2 cut(s)	355, 790
Bse1I	ACTGG	1 cut(s)	451
Bse3DI	GCAATG	4 cut(s)	139, 216, 313, 729
BseBI	CCWGG	3 cut(s)	356, 401, 651
BseDI	CCNNGG	1 cut(s)	141
BseLI	CCNNNNNNNGG	2 cut(s)	355, 790
BseMI	GCAATG	4 cut(s)	139, 216, 313, 729
BseNI	ACTGG	1 cut(s)	451
BseRI	GAGGAG	2 cut(s)	321, 408
BseXI	GCAGC	4 cut(s)	101, 197, 541, 727
BsgI	GTGCAG	3 cut(s)	445, 726, 822
BshFI	GGCC	3 cut(s)	177, 698, 783
BsiSI	CCGG	2 cut(s)	12, 580
BslI	CCNNNNNNNGG	2 cut(s)	355, 790
BsmAI	GTCTC	1 cut(s)	552
BsnI	GGCC	3 cut(s)	177, 698, 783
Bsp143I	GATC	4 cut(s)	367, 432, 576, 844
BspACI	CCGC	1 cut(s)	439
BspANI	GGCC	3 cut(s)	177, 698, 783
BspHI	TCATGA	1 cut(s)	375
BspLI	GGNNCC	3 cut(s)	139, 578, 697
BspMAI	CTGCAG	1 cut(s)	559
BspMI	ACCTGC	1 cut(s)	302
BspPI	GGATC	3 cut(s)	427, 571, 584
BsrDI	GCAATG	4 cut(s)	139, 216, 313, 729
BsrI	ACTGG	1 cut(s)	451
BssECI	CCNNGG	1 cut(s)	141
BssMI	GATC	4 cut(s)	367, 432, 576, 844
BssT1I	CCWWGG	1 cut(s)	141
Bst2UI	CCWGG	3 cut(s)	356, 401, 651
Bst4CI	ACNGT	1 cut(s)	716
Bst6I	CTCTTC	1 cut(s)	657
BstBAI	YACGTR	1 cut(s)	425
BstC8I	GCNNGC	5 cut(s)	211, 287, 417, 469, 569
BstDEI	CTNAG	2 cut(s)	276, 700
BstKTI	GATC	4 cut(s)	370, 435, 579, 847
BstMAI	GTCTC	1 cut(s)	552
BstMBI	GATC	4 cut(s)	367, 432, 576, 844
BstMWI	GCNNNNNNNGC	7 cut(s)	33, 286, 317, 447, 468, 568, 740
BstNI	CCWGG	3 cut(s)	356, 401, 651
BstSCI	CCNGG	4 cut(s)	354, 399, 579, 649
BstSFI	CTRYAG	2 cut(s)	258, 555
BstV1I	GCAGC	4 cut(s)	101, 197, 541, 727
BstX2I	RGATCY	1 cut(s)	576
BstYI	RGATCY	1 cut(s)	576
BsuRI	GGCC	3 cut(s)	177, 698, 783
BtgZI	GCGATG	1 cut(s)	671
BtsI	GCAGTG	1 cut(s)	366
BtsIMutI	CAGTG	2 cut(s)	74, 366
BveI	ACCTGC	1 cut(s)	302
Cac8I	GCNNGC	5 cut(s)	211, 287, 417, 469, 569
CaiI	CAGNNNCTG	1 cut(s)	656
CciI	TCATGA	1 cut(s)	375
Cfr13I	GGNCC	3 cut(s)	200, 346, 696
CseI	GACGC	2 cut(s)	191, 460
CspCI	CAANNNNNGTGG	2 cut(s)	324, 359
CviAII	CATG	2 cut(s)	376, 572
DdeI	CTNAG	2 cut(s)	276, 700
DpnI	GATC	4 cut(s)	369, 434, 578, 846
DpnII	GATC	4 cut(s)	367, 432, 576, 844
EaeI	YGGCCR	2 cut(s)	175, 781
Eam1104I	CTCTTC	1 cut(s)	657
EarI	CTCTTC	1 cut(s)	657
Eco130I	CCWWGG	1 cut(s)	141
Eco32I	GATATC	1 cut(s)	160
Eco47I	GGWCC	2 cut(s)	200, 346
Eco57I	CTGAAG	1 cut(s)	741
Eco72I	CACGTG	1 cut(s)	425
EcoO109I	RGGNCCY	1 cut(s)	696
EcoRII	CCWGG	3 cut(s)	354, 399, 649
EcoRV	GATATC	1 cut(s)	160
EcoT14I	CCWWGG	1 cut(s)	141
ErhI	CCWWGG	1 cut(s)	141
FaeI	CATG	2 cut(s)	379, 575
FaiI	YATR	9 cut(s)	39, 101, 299, 377, 573, 593, 683, 774, 786
FatI	CATG	2 cut(s)	375, 571
FauI	CCCGC	1 cut(s)	446
Fnu4HI	GCNGC	4 cut(s)	90, 186, 555, 741
Fsp4HI	GCNGC	4 cut(s)	90, 186, 555, 741
FspBI	CTAG	3 cut(s)	42, 494, 752
GluI	GCNGC	4 cut(s)	90, 186, 555, 741
HaeIII	GGCC	3 cut(s)	177, 698, 783
HapII	CCGG	2 cut(s)	12, 580
HgaI	GACGC	2 cut(s)	191, 460
Hin1II	CATG	2 cut(s)	379, 575
HinfI	GANTC	3 cut(s)	239, 396, 637
HpaII	CCGG	2 cut(s)	12, 580
HphI	GGTGA	1 cut(s)	259
Hpy166II	GTNNAC	2 cut(s)	346, 719
Hpy188I	TCNGA	3 cut(s)	244, 642, 760
Hpy188III	TCNNGA	2 cut(s)	376, 820
Hpy8I	GTNNAC	2 cut(s)	346, 719
HpyAV	CCTTC	2 cut(s)	56, 698
HpyCH4III	ACNGT	1 cut(s)	716
HpyCH4IV	ACGT	2 cut(s)	387, 424
HpyF10VI	GCNNNNNNNGC	7 cut(s)	33, 286, 317, 447, 468, 568, 740
HpyF3I	CTNAG	2 cut(s)	276, 700
HpySE526I	ACGT	2 cut(s)	387, 424
Hsp92II	CATG	2 cut(s)	379, 575
Kzo9I	GATC	4 cut(s)	367, 432, 576, 844
LmnI	GCTCC	5 cut(s)	86, 137, 193, 653, 707
Lsp1109I	GCAGC	4 cut(s)	101, 197, 541, 727
LweI	GCATC	2 cut(s)	125, 754
MaeI	CTAG	3 cut(s)	42, 494, 752
MaeII	ACGT	2 cut(s)	387, 424
MaeIII	GTNAC	2 cut(s)	229, 472
MalI	GATC	4 cut(s)	369, 434, 578, 846
MboI	GATC	4 cut(s)	367, 432, 576, 844
MboII	GAAGA	3 cut(s)	40, 641, 674
MfeI	CAATTG	1 cut(s)	586
MflI	RGATCY	1 cut(s)	576
MlsI	TGGCCA	2 cut(s)	177, 783
MluCI	AATT	7 cut(s)	122, 408, 453, 586, 672, 678, 787
MluNI	TGGCCA	2 cut(s)	177, 783
MlyI	GAGTC	2 cut(s)	405, 646
MmeI	TCCRAC	3 cut(s)	187, 267, 635
MnlI	CCTC	4 cut(s)	342, 386, 482, 797
Mox20I	TGGCCA	2 cut(s)	177, 783
MscI	TGGCCA	2 cut(s)	177, 783
MseI	TTAA	3 cut(s)	411, 671, 856
MslI	CAYNNNNRTG	2 cut(s)	306, 386
Msp20I	TGGCCA	2 cut(s)	177, 783
MspI	CCGG	2 cut(s)	12, 580
MspR9I	CCNGG	4 cut(s)	356, 401, 581, 651
MunI	CAATTG	1 cut(s)	586
MvaI	CCWGG	3 cut(s)	356, 401, 651
MwoI	GCNNNNNNNGC	7 cut(s)	33, 286, 317, 447, 468, 568, 740
NciI	CCSGG	1 cut(s)	581
NdeII	GATC	4 cut(s)	367, 432, 576, 844
NlaIII	CATG	2 cut(s)	379, 575
NlaIV	GGNNCC	3 cut(s)	139, 578, 697
NmuCI	GTSAC	2 cut(s)	229, 472
PagI	TCATGA	1 cut(s)	375
PaqCI	CACCTGC	1 cut(s)	302
PfeI	GAWTC	1 cut(s)	239
PflMI	CCANNNNNTGG	1 cut(s)	790
PfoI	TCCNGGA	1 cut(s)	649
PkrI	GCNGC	4 cut(s)	91, 187, 556, 742
PleI	GAGTC	2 cut(s)	404, 645
PmaCI	CACGTG	1 cut(s)	425
PmlI	CACGTG	1 cut(s)	425
PpsI	GAGTC	2 cut(s)	404, 645
Ppu21I	YACGTR	1 cut(s)	425
Psp6I	CCWGG	3 cut(s)	354, 399, 649
PspCI	CACGTG	1 cut(s)	425
PspGI	CCWGG	3 cut(s)	354, 399, 649
PspN4I	GGNNCC	3 cut(s)	139, 578, 697
PspPI	GGNCC	3 cut(s)	200, 346, 696
PstI	CTGCAG	1 cut(s)	559
PstNI	CAGNNNCTG	1 cut(s)	656
PsuI	RGATCY	1 cut(s)	576
RseI	CAYNNNNRTG	2 cut(s)	306, 386
SaqAI	TTAA	3 cut(s)	411, 671, 856
SatI	GCNGC	4 cut(s)	90, 186, 555, 741
Sau3AI	GATC	4 cut(s)	367, 432, 576, 844
Sau96I	GGNCC	3 cut(s)	200, 346, 696
SchI	GAGTC	2 cut(s)	405, 646
ScrFI	CCNGG	4 cut(s)	356, 401, 581, 651
SfaNI	GCATC	2 cut(s)	125, 754
SfcI	CTRYAG	2 cut(s)	258, 555
SinI	GGWCC	2 cut(s)	200, 346
SmiMI	CAYNNNNRTG	2 cut(s)	306, 386
SpeI	ACTAGT	1 cut(s)	41
Sse9I	AATT	7 cut(s)	122, 408, 453, 586, 672, 678, 787
SsiI	CCGC	1 cut(s)	439
SspMI	CTAG	3 cut(s)	42, 494, 752
StyD4I	CCNGG	4 cut(s)	354, 399, 579, 649
StyI	CCWWGG	1 cut(s)	141
TaaI	ACNGT	1 cut(s)	716
TaiI	ACGT	2 cut(s)	390, 427
TaqI	TCGA	1 cut(s)	627
TasI	AATT	7 cut(s)	122, 408, 453, 586, 672, 678, 787
TfiI	GAWTC	1 cut(s)	239
Tru1I	TTAA	3 cut(s)	411, 671, 856
Tru9I	TTAA	3 cut(s)	411, 671, 856
TscAI	CASTG	2 cut(s)	81, 366
TseFI	GTSAC	2 cut(s)	229, 472
TseI	GCWGC	4 cut(s)	89, 185, 554, 740
Tsp45I	GTSAC	2 cut(s)	229, 472
TspDTI	ATGAA	4 cut(s)	115, 205, 392, 675
TspRI	CASTG	2 cut(s)	81, 366
Van91I	CCANNNNNTGG	1 cut(s)	790
VpaK11BI	GGWCC	2 cut(s)	200, 346
XapI	RAATTY	1 cut(s)	122
XcmI	CCANNNNNNNNNTGG	1 cut(s)	170
XspI	CTAG	3 cut(s)	42, 494, 752

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.