Rmu_sc0009637.1_g000003

Survival motor neuron (SMN) interacting protein 1 (SIP1)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009637.1
Physical Location & Seq
Reverse (-)
5153 .. 11294
6142 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009637.1_g000003.1.cds

Sequence Viewer

Length: 1212 bp
atggcagacgatatgggttctgatactacatgcgtcggcagcaagcgaagcgtggaagagatcgaagagattcaaactgggtctccaattccagagcaagatagccaccacacaaacacgtctgacatcgtttcgcctctgaaacaagaccacgacttcatccccaagaccccgtctttcctcgtctctgagtcctccaagaaggtcaagtcttcacctgactacgcccaagatatgcccgcttctgggttttctgcttctgattctgtgggaaatgaagtgggtctctctggaattcaagaaagcaagaacgaaggcttggctgctgctgagaatctcttggatgtgaaaaagaagcaattgttggaggaggttgaagccaatcttgtccctgcagagaaaaaggtctcttctttgagagttgaaataattgatgaaactgcattgattgaaactttcaagccaatgggttttctgggtcatgctaagtctggtgcacagaggaatgcaaagcaagaagttaatggaaagaaggcaagaaaccaacgaaggaaagagaagctggcaaatgggttcaagcctgagaataccattcatgtggttcaacctcctcacagctcaggagtcaagaagatcacttactcgagggtggagttggaggccatgcggtttgtgaacgttgcagaacagaggaagctgtgggaacatgtgtacaatgggcttgggccagtggtggcaagggagtatgatgatctggcagtctctaagcatcagaagaacatccagttcaactctgatcatcgtaagccctatgggaagatggaccaggcacctggcattcttggtggtagtgcctcaccccctgtggaaaacttcagtcctaaagcttctgtggatcatagttccagagactccccgttgttgtctgtgatttttagattggactctgttgctagagtatctatgttgagaaaacgcataaaggcagcagaggacaccagcacactgtcaagggatgattgcctgtggctatttgcgctgtgtgcagtagttgatactccactggatgctgacaccagtgcttctgtgcggagtctgctaaggaagtgtgctgcattgcgagctacaaaatctacggttgacgatgagttgataatgttgaatattcttgccacaatatcaggtagatatttcgggcagtcagaaaactga

Protein Analysis

403

Amino Acids

44.19

Weight (kDa)

6.4

Isoelectric Point (pI)

46.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 829
AciI CCGC 3 cut(s) 240, 667, 1090
AclI AACGTT 1 cut(s) 678
AclWI GGATC 1 cut(s) 903
AcsI RAATTY 1 cut(s) 294
AcuI CTGAAG 1 cut(s) 859
AfaI GTAC 1 cut(s) 713
AfiI CCNNNNNNNGG 2 cut(s) 245, 246
AflIII ACRYGT 2 cut(s) 117, 706
AjiI CACGTC 1 cut(s) 120
AjnI CCWGG 2 cut(s) 825, 832
AjuI GAANNNNNNNTTGG 4 cut(s) 302, 334, 347, 379
AluBI AGCT 5 cut(s) 562, 618, 697, 887, 1124
AluI AGCT 5 cut(s) 562, 618, 697, 887, 1124
Alw21I GWGCWC 1 cut(s) 499
Alw26I GTCTC 6 cut(s) 87, 190, 290, 412, 766, 903
Alw44I GTGCAC 1 cut(s) 495
AlwI GGATC 1 cut(s) 903
Ama87I CYCGRG 1 cut(s) 643
AoxI GGCC 2 cut(s) 660, 725
ApaLI GTGCAC 1 cut(s) 495
ApeKI GCWGC 5 cut(s) 39, 323, 326, 986, 1112
ApoI RAATTY 1 cut(s) 294
Asp700I GAANNNNTTC 1 cut(s) 69
AspLEI GCGC 1 cut(s) 1039
AspS9I GGNCC 2 cut(s) 725, 823
AsuHPI GGTGA 2 cut(s) 207, 849
AvaI CYCGRG 1 cut(s) 643
AvaII GGWCC 1 cut(s) 823
BaeGI GKGCMC 1 cut(s) 499
BanI GGYRCC 1 cut(s) 829
BarI GAAGNNNNNNTAC 2 cut(s) 623, 655
BbsI GAAGAC 1 cut(s) 204
Bbv12I GWGCWC 1 cut(s) 499
BbvI GCAGC 5 cut(s) 51, 310, 313, 998, 1099
BccI CCATC 1 cut(s) 814
BciT130I CCWGG 2 cut(s) 827, 834
BclI TGATCA 1 cut(s) 796
BcoDI GTCTC 6 cut(s) 87, 190, 290, 412, 766, 903
BfaI CTAG 1 cut(s) 954
BfmI CTRYAG 1 cut(s) 393
BisI GCNGC 5 cut(s) 40, 324, 327, 987, 1113
BlsI GCNGC 5 cut(s) 41, 325, 328, 988, 1114
Bme1390I CCNGG 2 cut(s) 827, 834
Bme18I GGWCC 1 cut(s) 823
BmeT110I CYCGRG 1 cut(s) 643
BmgBI CACGTC 1 cut(s) 120
BmgT120I GGNCC 2 cut(s) 725, 823
BmiI GGNNCC 1 cut(s) 831
BmrFI CCNGG 2 cut(s) 827, 834
BmrI ACTGGG 1 cut(s) 87
BmsI GCATC 2 cut(s) 778, 1057
BmuI ACTGGG 1 cut(s) 87
BpiI GAAGAC 1 cut(s) 204
Bpu10I CCTNAGC 2 cut(s) 619, 1100
BsaI GGTCTC 3 cut(s) 87, 290, 412
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bsc4I CCNNNNNNNGG 2 cut(s) 245, 246
Bse1I ACTGG 5 cut(s) 82, 728, 784, 1068, 1077
Bse3DI GCAATG 1 cut(s) 1115
BseBI CCWGG 2 cut(s) 827, 834
BseGI GGATG 5 cut(s) 159, 349, 780, 1021, 1072
BseLI CCNNNNNNNGG 2 cut(s) 245, 246
BseMI GCAATG 1 cut(s) 1115
BseMII CTCAG 4 cut(s) 180, 321, 573, 633
BseNI ACTGG 5 cut(s) 82, 728, 784, 1068, 1077
BseRI GAGGAG 2 cut(s) 383, 600
BseSI GKGCMC 1 cut(s) 499
BseXI GCAGC 5 cut(s) 51, 310, 313, 998, 1099
BsgI GTGCAG 1 cut(s) 1065
BshFI GGCC 2 cut(s) 662, 727
BshNI GGYRCC 1 cut(s) 829
BsiHKAI GWGCWC 1 cut(s) 499
BsiHKCI CYCGRG 1 cut(s) 643
BslFI GGGAC 1 cut(s) 374
BslI CCNNNNNNNGG 2 cut(s) 245, 246
BsmAI GTCTC 6 cut(s) 87, 190, 290, 412, 766, 903
BsmBI CGTCTC 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 374
BsmI GAATGC 2 cut(s) 511, 837
BsnI GGCC 2 cut(s) 662, 727
Bso31I GGTCTC 3 cut(s) 87, 290, 412
BsoBI CYCGRG 1 cut(s) 643
Bsp1286I GDGCHC 1 cut(s) 499
Bsp1407I TGTACA 1 cut(s) 711
Bsp143I GATC 5 cut(s) 60, 633, 751, 796, 895
BspACI CCGC 3 cut(s) 240, 667, 1090
BspANI GGCC 2 cut(s) 662, 727
BspCNI CTCAG 4 cut(s) 181, 322, 574, 632
BspLI GGNNCC 1 cut(s) 831
BspMAI CTGCAG 1 cut(s) 397
BspPI GGATC 1 cut(s) 903
BspT107I GGYRCC 1 cut(s) 829
BspTNI GGTCTC 3 cut(s) 87, 290, 412
BsrDI GCAATG 1 cut(s) 1115
BsrGI TGTACA 1 cut(s) 711
BsrI ACTGG 5 cut(s) 82, 728, 784, 1068, 1077
BssMI GATC 5 cut(s) 60, 633, 751, 796, 895
Bst2UI CCWGG 2 cut(s) 827, 834
Bst4CI ACNGT 2 cut(s) 1008, 1138
Bst6I CTCTTC 3 cut(s) 51, 60, 415
BstAUI TGTACA 1 cut(s) 711
BstC8I GCNNGC 4 cut(s) 44, 240, 564, 1122
BstDEI CTNAG 7 cut(s) 189, 330, 486, 582, 619, 765, 1100
BstF5I GGATG 5 cut(s) 159, 349, 780, 1021, 1072
BstHHI GCGC 1 cut(s) 1039
BstKTI GATC 5 cut(s) 63, 636, 754, 799, 898
BstMAI GTCTC 6 cut(s) 87, 190, 290, 412, 766, 903
BstMBI GATC 5 cut(s) 60, 633, 751, 796, 895
BstMWI GCNNNNNNNGC 6 cut(s) 39, 48, 1036, 1043, 1096, 1121
BstNI CCWGG 2 cut(s) 827, 834
BstNSI RCATGY 2 cut(s) 33, 710
BstSCI CCNGG 2 cut(s) 825, 832
BstSFI CTRYAG 1 cut(s) 393
BstSLI GKGCMC 1 cut(s) 499
BstV1I GCAGC 5 cut(s) 51, 310, 313, 998, 1099
BstV2I GAAGAC 1 cut(s) 204
BstXI CCANNNNNNTGG 2 cut(s) 598, 833
BsuRI GGCC 2 cut(s) 662, 727
BtrI CACGTC 1 cut(s) 120
BtsCI GGATG 5 cut(s) 159, 349, 780, 1021, 1072
BtsIMutI CAGTG 4 cut(s) 735, 1004, 1061, 1084
Cac8I GCNNGC 4 cut(s) 44, 240, 564, 1122
CfoI GCGC 1 cut(s) 1039
Cfr13I GGNCC 2 cut(s) 725, 823
CseI GACGC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 712
CviAII CATG 5 cut(s) 30, 482, 596, 664, 707
CviQI GTAC 1 cut(s) 712
DdeI CTNAG 7 cut(s) 189, 330, 486, 582, 619, 765, 1100
DpnI GATC 5 cut(s) 62, 635, 753, 798, 897
DpnII GATC 5 cut(s) 60, 633, 751, 796, 895
Eam1104I CTCTTC 3 cut(s) 51, 60, 415
EarI CTCTTC 3 cut(s) 51, 60, 415
Eco31I GGTCTC 3 cut(s) 87, 290, 412
Eco47I GGWCC 1 cut(s) 823
Eco57I CTGAAG 1 cut(s) 859
Eco88I CYCGRG 1 cut(s) 643
EcoRI GAATTC 1 cut(s) 294
EcoRII CCWGG 2 cut(s) 825, 832
Esp3I CGTCTC 1 cut(s) 190
FaeI CATG 5 cut(s) 33, 485, 599, 667, 710
FalI AAGNNNNNCTT 2 cut(s) 369, 401
FaqI GGGAC 1 cut(s) 374
FatI CATG 5 cut(s) 29, 481, 595, 663, 706
FauI CCCGC 1 cut(s) 247
FbaI TGATCA 1 cut(s) 796
Fnu4HI GCNGC 5 cut(s) 40, 324, 327, 987, 1113
FokI GGATG 5 cut(s) 146, 356, 767, 1028, 1079
Fsp4HI GCNGC 5 cut(s) 40, 324, 327, 987, 1113
FspBI CTAG 1 cut(s) 954
GlaI GCGC 1 cut(s) 1038
GluI GCNGC 5 cut(s) 40, 324, 327, 987, 1113
HaeIII GGCC 2 cut(s) 662, 727
HgaI GACGC 1 cut(s) 22
HhaI GCGC 1 cut(s) 1039
Hin1II CATG 5 cut(s) 33, 485, 599, 667, 710
Hin6I GCGC 1 cut(s) 1037
HinP1I GCGC 1 cut(s) 1037
HincII GTYRAC 1 cut(s) 1141
HindII GTYRAC 1 cut(s) 1141
HindIII AAGCTT 1 cut(s) 885
HinfI GANTC 8 cut(s) 70, 191, 263, 334, 624, 911, 944, 1093
HphI GGTGA 2 cut(s) 207, 849
Hpy166II GTNNAC 4 cut(s) 497, 676, 712, 1141
Hpy188I TCNGA 8 cut(s) 22, 124, 141, 190, 262, 774, 796, 1204
Hpy188III TCNNGA 6 cut(s) 92, 291, 299, 621, 628, 906
Hpy8I GTNNAC 4 cut(s) 497, 676, 712, 1141
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 4 cut(s) 196, 308, 526, 543
HpyCH4III ACNGT 2 cut(s) 1008, 1138
HpyCH4IV ACGT 2 cut(s) 119, 678
HpyCH4V TGCA 7 cut(s) 395, 443, 497, 509, 683, 1046, 1115
HpyF10VI GCNNNNNNNGC 6 cut(s) 39, 48, 1036, 1043, 1096, 1121
HpyF3I CTNAG 7 cut(s) 189, 330, 486, 582, 619, 765, 1100
HpySE526I ACGT 2 cut(s) 119, 678
Hsp92II CATG 5 cut(s) 33, 485, 599, 667, 710
HspAI GCGC 1 cut(s) 1037
Ksp22I TGATCA 1 cut(s) 796
Kzo9I GATC 5 cut(s) 60, 633, 751, 796, 895
Lsp1109I GCAGC 5 cut(s) 51, 310, 313, 998, 1099
LweI GCATC 2 cut(s) 778, 1057
MaeI CTAG 1 cut(s) 954
MaeII ACGT 2 cut(s) 119, 678
MalI GATC 5 cut(s) 62, 635, 753, 798, 897
MboI GATC 5 cut(s) 60, 633, 751, 796, 895
MboII GAAGA 7 cut(s) 68, 77, 204, 402, 643, 787, 829
MfeI CAATTG 1 cut(s) 359
MhlI GDGCHC 1 cut(s) 499
MluCI AATT 4 cut(s) 87, 294, 359, 429
MlyI GAGTC 5 cut(s) 200, 633, 905, 938, 1102
MmeI TCCRAC 2 cut(s) 345, 636
MroXI GAANNNNTTC 1 cut(s) 69
MseI TTAA 1 cut(s) 522
MslI CAYNNNNRTG 1 cut(s) 596
MspR9I CCNGG 2 cut(s) 827, 834
MunI CAATTG 1 cut(s) 359
Mva1269I GAATGC 2 cut(s) 511, 837
MvaI CCWGG 2 cut(s) 827, 834
MwoI GCNNNNNNNGC 6 cut(s) 39, 48, 1036, 1043, 1096, 1121
NdeII GATC 5 cut(s) 60, 633, 751, 796, 895
NlaIII CATG 5 cut(s) 33, 485, 599, 667, 710
NlaIV GGNNCC 1 cut(s) 831
NspI RCATGY 2 cut(s) 33, 710
PaeR7I CTCGAG 1 cut(s) 643
PciI ACATGT 1 cut(s) 706
PctI GAATGC 2 cut(s) 511, 837
PdmI GAANNNNTTC 1 cut(s) 69
PfeI GAWTC 3 cut(s) 70, 263, 334
PflFI GACNNNGTC 1 cut(s) 172
PkrI GCNGC 5 cut(s) 41, 325, 328, 988, 1114
PleI GAGTC 5 cut(s) 199, 632, 905, 938, 1101
PpsI GAGTC 5 cut(s) 199, 632, 905, 938, 1101
PscI ACATGT 1 cut(s) 706
Psp1406I AACGTT 1 cut(s) 678
Psp6I CCWGG 2 cut(s) 825, 832
PspGI CCWGG 2 cut(s) 825, 832
PspN4I GGNNCC 1 cut(s) 831
PspPI GGNCC 2 cut(s) 725, 823
PspXI VCTCGAGB 1 cut(s) 643
PstI CTGCAG 1 cut(s) 397
PsyI GACNNNGTC 1 cut(s) 172
RsaI GTAC 1 cut(s) 713
RsaNI GTAC 1 cut(s) 712
RseI CAYNNNNRTG 1 cut(s) 596
SaqAI TTAA 1 cut(s) 522
SatI GCNGC 5 cut(s) 40, 324, 327, 987, 1113
Sau3AI GATC 5 cut(s) 60, 633, 751, 796, 895
Sau96I GGNCC 2 cut(s) 725, 823
SchI GAGTC 5 cut(s) 200, 633, 905, 938, 1102
ScrFI CCNGG 2 cut(s) 827, 834
SduI GDGCHC 1 cut(s) 499
SfaNI GCATC 2 cut(s) 778, 1057
SfcI CTRYAG 1 cut(s) 393
Sfr274I CTCGAG 1 cut(s) 643
SinI GGWCC 1 cut(s) 823
SlaI CTCGAG 1 cut(s) 643
SmiMI CAYNNNNRTG 1 cut(s) 596
SmlI CTYRAG 1 cut(s) 643
SmoI CTYRAG 1 cut(s) 643
Sse9I AATT 4 cut(s) 87, 294, 359, 429
SsiI CCGC 3 cut(s) 240, 667, 1090
SspI AATATT 1 cut(s) 1165
SspMI CTAG 1 cut(s) 954
StyD4I CCNGG 2 cut(s) 825, 832
TaaI ACNGT 2 cut(s) 1008, 1138
TaiI ACGT 2 cut(s) 122, 681
TaqI TCGA 2 cut(s) 63, 644
TasI AATT 4 cut(s) 87, 294, 359, 429
TatI WGTACW 1 cut(s) 711
TfiI GAWTC 3 cut(s) 70, 263, 334
Tru1I TTAA 1 cut(s) 522
Tru9I TTAA 1 cut(s) 522
TscAI CASTG 4 cut(s) 735, 1011, 1068, 1084
TseI GCWGC 5 cut(s) 39, 323, 326, 986, 1112
TspDTI ATGAA 4 cut(s) 148, 291, 450, 584
TspRI CASTG 4 cut(s) 735, 1011, 1068, 1084
Tth111I GACNNNGTC 1 cut(s) 172
VneI GTGCAC 1 cut(s) 495
VpaK11BI GGWCC 1 cut(s) 823
XapI RAATTY 1 cut(s) 294
XceI RCATGY 2 cut(s) 33, 710
XhoI CTCGAG 1 cut(s) 643
XmnI GAANNNNTTC 1 cut(s) 69
XspI CTAG 1 cut(s) 954
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.