Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0003622

Physical Location & Seq

Genomic Coordinates Forward (+)

50340517 .. 50347588

Gene Structure 7072 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00255900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 513 bp

ATGACTCAAACTGATGTTCAGAAGTACTCAAATATTTTCGTGAAAGTCGACACAGACAGAGATGGGAAAATCACTGGTGACTTATTTTTGAAATGGGGATTGCCAAGAGAGATTTTTAAGCAGATGTGGAAAGATGTAAACAGTGGGCTTGGACTAGTGGTGGCAAGAGAGTATGATGATCCGGCAATCTCTAAGCATCGAACAATATCCAGTTCAACGTACTCTAGTCATCGTAAGTGCTTTGGGAAGATGGATGAGGCACCTAGCATTATTATTTTGACTCATGAACATGCTGATGCGGTTCTTGGTCCAGATGATATACATGTCGTTCAGCCATTTAGTCCCACAAATGACATTGATCCTACTCCCATCTATCTAACTCAATTTGCACTGGAAAGGTACTCCATTTCAGTCCTGTACCTGATGACCAATCTGATCCAGCGATCAAGTTTTCCTATTAGCAAACTAATGCACAAGGAGAATAGTGTTTCGGCCCAACTAAGTCCTGACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EF-hand_4 EF-hand_5

Protein Analysis

170

Amino Acids

19.26

Weight (kDa)

6.05

Isoelectric Point (pI)

31.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003622)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G54380
fragaria_vesca	FvH4_4g11290 FvH4_4g11290
malus_domestica	MD04G1038300.v1.1 MD04G1038400.v1.1 MD13G1258700.v1.1 MD16G1211800.v1.1
prunus_persica	Prupe.1G188800_v2.0.a1 Prupe.1G188800_v2.0.a1 Prupe.1G188800_v2.0.a1 Prupe.1G189100_v2.0.a1 Prupe.1G189100_v2.0.a1
pyrus_communis	pycom04g02980 pycom04g03120
rosa_chinensis	RchiOBHm_Chr4g0407521 RchiOBHm_Chr4g0407531
rosa_laevigata	RLG00000008713
rosa_multiflora	Rmu_co8210254.1_g000001 Rmu_sc0004841.1_g000011 Rmu_sc0009637.1_g000003
rosa_roxburghii	Rroxscaffold_3G00255900 Rroxscaffold_3G00257360 Rroxscaffold_5G00352150 Rroxscaffold_5G00366810
rosa_rugosa	Rorug04G0080200 Rorug04G0080200
rosa_samantha	Rh1AG095200 Rh2DG536300 Rh4AG144800 Rh4BG142700 Rh4CG151500 Rh4DG138700 Rh5AG108700
rosa_wichuraiana	Rw4G011770 Rw5G009490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	259
AccI	GTMKAC	1 cut(s)	48
AciI	CCGC	1 cut(s)	299
AclWI	GGATC	3 cut(s)	173, 353, 430
AfaI	GTAC	4 cut(s)	26, 221, 401, 419
AflIII	ACRYGT	1 cut(s)	322
AgsI	TTSAA	2 cut(s)	91, 216
AhlI	ACTAGT	1 cut(s)	154
AlwI	GGATC	3 cut(s)	173, 353, 430
AoxI	GGCC	1 cut(s)	492
AspS9I	GGNCC	2 cut(s)	308, 493
AsuHPI	GGTGA	1 cut(s)	89
AvaII	GGWCC	1 cut(s)	308
BanI	GGYRCC	1 cut(s)	259
BccI	CCATC	3 cut(s)	56, 244, 377
BcuI	ACTAGT	1 cut(s)	154
BfaI	CTAG	4 cut(s)	155, 225, 264, 511
BmcAI	AGTACT	1 cut(s)	26
Bme18I	GGWCC	1 cut(s)	308
BmgT120I	GGNCC	2 cut(s)	308, 493
BmiI	GGNNCC	1 cut(s)	261
BmsI	GCATC	2 cut(s)	205, 286
Bse1I	ACTGG	3 cut(s)	79, 210, 396
BseGI	GGATG	1 cut(s)	259
BseNI	ACTGG	3 cut(s)	79, 210, 396
BshFI	GGCC	1 cut(s)	494
BshNI	GGYRCC	1 cut(s)	259
BsiSI	CCGG	1 cut(s)	182
BslFI	GGGAC	1 cut(s)	327
BsmFI	GGGAC	1 cut(s)	327
BsnI	GGCC	1 cut(s)	494
Bsp143I	GATC	4 cut(s)	178, 358, 435, 443
BspACI	CCGC	1 cut(s)	299
BspANI	GGCC	1 cut(s)	494
BspHI	TCATGA	1 cut(s)	283
BspLI	GGNNCC	1 cut(s)	261
BspPI	GGATC	3 cut(s)	173, 353, 430
BspT107I	GGYRCC	1 cut(s)	259
BsrI	ACTGG	3 cut(s)	79, 210, 396
BssMI	GATC	4 cut(s)	178, 358, 435, 443
Bst4CI	ACNGT	1 cut(s)	143
BstDEI	CTNAG	2 cut(s)	192, 500
BstF5I	GGATG	1 cut(s)	259
BstKTI	GATC	4 cut(s)	181, 361, 438, 446
BstMBI	GATC	4 cut(s)	178, 358, 435, 443
BstNSI	RCATGY	2 cut(s)	293, 326
BsuRI	GGCC	1 cut(s)	494
BtsCI	GGATG	1 cut(s)	259
BtsIMutI	CAGTG	3 cut(s)	72, 148, 389
CciI	TCATGA	1 cut(s)	283
Cfr13I	GGNCC	2 cut(s)	308, 493
Csp6I	GTAC	4 cut(s)	25, 220, 400, 418
CviAII	CATG	3 cut(s)	284, 290, 323
CviJI	RGCY	3 cut(s)	148, 334, 494
CviKI_1	RGCY	3 cut(s)	148, 334, 494
CviQI	GTAC	4 cut(s)	25, 220, 400, 418
DdeI	CTNAG	2 cut(s)	192, 500
DpnI	GATC	4 cut(s)	180, 360, 437, 445
DpnII	GATC	4 cut(s)	178, 358, 435, 443
Eco47I	GGWCC	1 cut(s)	308
FaeI	CATG	3 cut(s)	287, 293, 326
FaiI	YATR	5 cut(s)	174, 285, 291, 320, 324
FaqI	GGGAC	1 cut(s)	327
FatI	CATG	3 cut(s)	283, 289, 322
FblI	GTMKAC	1 cut(s)	48
FokI	GGATG	1 cut(s)	266
FspBI	CTAG	4 cut(s)	155, 225, 264, 511
HaeIII	GGCC	1 cut(s)	494
HapII	CCGG	1 cut(s)	182
Hin1II	CATG	3 cut(s)	287, 293, 326
HincII	GTYRAC	1 cut(s)	49
HindII	GTYRAC	1 cut(s)	49
HinfI	GANTC	2 cut(s)	4, 280
HpaII	CCGG	1 cut(s)	182
HphI	GGTGA	1 cut(s)	89
Hpy166II	GTNNAC	2 cut(s)	49, 139
Hpy188I	TCNGA	2 cut(s)	21, 435
Hpy188III	TCNNGA	4 cut(s)	40, 284, 311, 506
Hpy8I	GTNNAC	2 cut(s)	49, 139
HpyCH4III	ACNGT	1 cut(s)	143
HpyCH4IV	ACGT	1 cut(s)	218
HpyCH4V	TGCA	2 cut(s)	389, 472
HpyF3I	CTNAG	2 cut(s)	192, 500
HpySE526I	ACGT	1 cut(s)	218
Hsp92II	CATG	3 cut(s)	287, 293, 326
Kzo9I	GATC	4 cut(s)	178, 358, 435, 443
LpnPI	CCDG	8 cut(s)	60, 195, 223, 324, 377, 428, 434, 452
LweI	GCATC	2 cut(s)	205, 286
MaeI	CTAG	4 cut(s)	155, 225, 264, 511
MaeII	ACGT	1 cut(s)	218
MaeIII	GTNAC	1 cut(s)	77
MalI	GATC	4 cut(s)	180, 360, 437, 445
MboI	GATC	4 cut(s)	178, 358, 435, 443
MboII	GAAGA	1 cut(s)	259
MluCI	AATT	1 cut(s)	383
MlyI	GAGTC	1 cut(s)	274
MnlI	CCTC	1 cut(s)	250
MseI	TTAA	1 cut(s)	117
MslI	CAYNNNNRTG	2 cut(s)	288, 294
MspI	CCGG	1 cut(s)	182
NdeII	GATC	4 cut(s)	178, 358, 435, 443
NlaIII	CATG	3 cut(s)	287, 293, 326
NlaIV	GGNNCC	1 cut(s)	261
NmuCI	GTSAC	1 cut(s)	77
NspI	RCATGY	2 cut(s)	293, 326
PagI	TCATGA	1 cut(s)	283
PciI	ACATGT	1 cut(s)	322
PcsI	WCGNNNNNNNCGW	1 cut(s)	45
PleI	GAGTC	1 cut(s)	274
PpsI	GAGTC	1 cut(s)	274
PscI	ACATGT	1 cut(s)	322
PspN4I	GGNNCC	1 cut(s)	261
PspPI	GGNCC	2 cut(s)	308, 493
RsaI	GTAC	4 cut(s)	26, 221, 401, 419
RsaNI	GTAC	4 cut(s)	25, 220, 400, 418
RseI	CAYNNNNRTG	2 cut(s)	288, 294
SalI	GTCGAC	1 cut(s)	47
SaqAI	TTAA	1 cut(s)	117
Sau3AI	GATC	4 cut(s)	178, 358, 435, 443
Sau96I	GGNCC	2 cut(s)	308, 493
ScaI	AGTACT	1 cut(s)	26
SchI	GAGTC	1 cut(s)	274
SetI	ASST	4 cut(s)	221, 265, 401, 423
SfaNI	GCATC	2 cut(s)	205, 286
SinI	GGWCC	1 cut(s)	308
SmiMI	CAYNNNNRTG	2 cut(s)	288, 294
SpeI	ACTAGT	1 cut(s)	154
Sse9I	AATT	1 cut(s)	383
SsiI	CCGC	1 cut(s)	299
SspI	AATATT	1 cut(s)	34
SspMI	CTAG	4 cut(s)	155, 225, 264, 511
TaaI	ACNGT	1 cut(s)	143
TaiI	ACGT	1 cut(s)	221
TaqI	TCGA	2 cut(s)	48, 199
TasI	AATT	1 cut(s)	383
TatI	WGTACW	1 cut(s)	24
Tru1I	TTAA	1 cut(s)	117
Tru9I	TTAA	1 cut(s)	117
TscAI	CASTG	3 cut(s)	79, 148, 396
TseFI	GTSAC	1 cut(s)	77
Tsp45I	GTSAC	1 cut(s)	77
TspDTI	ATGAA	1 cut(s)	300
TspRI	CASTG	3 cut(s)	79, 148, 396
VpaK11BI	GGWCC	1 cut(s)	308
XceI	RCATGY	2 cut(s)	293, 326
XmiI	GTMKAC	1 cut(s)	48
XspI	CTAG	4 cut(s)	155, 225, 264, 511
ZrmI	AGTACT	1 cut(s)	26

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.