Rh2DG536300

Survival motor neuron (SMN) interacting protein 1 (SIP1)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
76623174 .. 76625784
2611 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG536300.1

Sequence Viewer

Length: 231 bp
ATGTGGAAAGATGTATACAATGGGCTTGGACTGGTGGTGGCAAGAGAGTATGATGATCTGGCAATCTCTAAACATCAAAACAATATCCAGTTCAACTCTAGTCATCGCAAGTGCTTTGGGAAGATGGATGAGGCACCTAGCATTGTTGAATCAAAGGGAATAGACTCAATAGAGGGGGGAAAGAAGCAAAAACAGAATGGCGCACCGCTGGAAGCACCAAACACAGTTTAA

Protein Analysis

76

Amino Acids

8.4

Weight (kDa)

6.71

Isoelectric Point (pI)

40.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 133
AccI GTMKAC 1 cut(s) 15
AciI CCGC 1 cut(s) 206
AgsI TTSAA 2 cut(s) 94, 149
AspLEI GCGC 1 cut(s) 203
BanI GGYRCC 1 cut(s) 133
BccI CCATC 1 cut(s) 118
BfaI CTAG 2 cut(s) 99, 138
BmiI GGNNCC 1 cut(s) 135
Bse1I ACTGG 2 cut(s) 36, 88
BseGI GGATG 1 cut(s) 133
BseNI ACTGG 2 cut(s) 36, 88
BshNI GGYRCC 1 cut(s) 133
Bsp143I GATC 1 cut(s) 55
BspACI CCGC 1 cut(s) 206
BspLI GGNNCC 1 cut(s) 135
BspT107I GGYRCC 1 cut(s) 133
BsrI ACTGG 2 cut(s) 36, 88
BssMI GATC 1 cut(s) 55
BssNAI GTATAC 1 cut(s) 16
Bst1107I GTATAC 1 cut(s) 16
Bst4CI ACNGT 1 cut(s) 226
BstF5I GGATG 1 cut(s) 133
BstHHI GCGC 1 cut(s) 203
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstZ17I GTATAC 1 cut(s) 16
BtgZI GCGATG 1 cut(s) 89
BtsCI GGATG 1 cut(s) 133
CfoI GCGC 1 cut(s) 203
CviJI RGCY 1 cut(s) 25
CviKI_1 RGCY 1 cut(s) 25
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
FaiI YATR 2 cut(s) 16, 51
FblI GTMKAC 1 cut(s) 15
FokI GGATG 1 cut(s) 140
FspBI CTAG 2 cut(s) 99, 138
GlaI GCGC 1 cut(s) 202
HhaI GCGC 1 cut(s) 203
Hin6I GCGC 1 cut(s) 201
HinP1I GCGC 1 cut(s) 201
HinfI GANTC 2 cut(s) 149, 164
Hpy166II GTNNAC 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 16
HpyCH4III ACNGT 1 cut(s) 226
HspAI GCGC 1 cut(s) 201
Kzo9I GATC 1 cut(s) 55
LpnPI CCDG 4 cut(s) 17, 44, 101, 194
MaeI CTAG 2 cut(s) 99, 138
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 1 cut(s) 133
MlyI GAGTC 1 cut(s) 158
MnlI CCTC 2 cut(s) 124, 166
MseI TTAA 1 cut(s) 229
MspA1I CMGCKG 1 cut(s) 208
NdeII GATC 1 cut(s) 55
NlaIV GGNNCC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 149
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
PspN4I GGNNCC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 229
Sau3AI GATC 1 cut(s) 55
SchI GAGTC 1 cut(s) 158
SetI ASST 1 cut(s) 139
SgeI CNNG 9 cut(s) 38, 44, 54, 71, 100, 111, 121, 150, 221
SsiI CCGC 1 cut(s) 206
SspMI CTAG 2 cut(s) 99, 138
TaaI ACNGT 1 cut(s) 226
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 1 cut(s) 229
Tru9I TTAA 1 cut(s) 229
XmiI GTMKAC 1 cut(s) 15
XspI CTAG 2 cut(s) 99, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.