Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009812.1

Orthogroup ID

OG0003235

Physical Location & Seq

Genomic Coordinates Forward (+)

27502 .. 31195

Gene Structure 3694 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009812.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 900 bp

atgccagtaatcggtcttggtgtttggcgcatggaaggaaaagaaatcagagacctcatcatcaattccatcaacattggttatcgccattttgactgcgctgctgattacaagaatgaatcagaagttggagaggcactagcagaagcattttccactgggcttgttaagcgagaggatctcttcatcaccaccaagctttggaattcagatcacggacatgttgtggaggcctgtaaagacagtctaaagaagcttcggttagattatctagatctgtaccttgttcactttcctgttgccacaaagcacaccggagttggtgcaactgacagtgctttggatgaggatggggtgctagagatagacacaaccatttctctagaaactacttggcgtgctatggaagatctggtttctctgggtttagttcgtagtattgggatcagcaactatgacatctttctcactagagattgcttagcctattccaaagtgaagcctgctgtgaatcagattgaaactcacccatacttccagcgtgattctcttgtcaaattctgtctgaaacacggcatctctgtcacagcccacactccacttggaggtgctgcagccaacactgaatggtttggttcagtttcagctctggatgatccagttctcaagaatcttgctgagaaatacaaaaagacagtggcccaggttgttcttcgatggggcattcaacgcaacacagttgtaatcccgaagacgtcaaaactcgagagattgaaagagaactttcaagtctttgactttgagatttccaaagaggacatggacctcattaaaaaggtggacaggaaactccggaccaatcaacctgccaagttttggggcgttgatctatttgcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00010 ko00040 ko00051 ko00052 ko00561 ko00790 ko00930 ko01100 ko01110 ko01120 ko01130 ko01220 map00010 map00040 map00051 map00052 map00561 map00790 map00930 map01100 map01110 map01120 map01130 map01220

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

299

Amino Acids

33.71

Weight (kDa)

6.09

Isoelectric Point (pI)

23.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003235)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21250 AT2G21250 AT2G21260 AT2G21260
fragaria_vesca	FvH4_2g10630
malus_domestica	MD02G1264100.v1.1 MD02G1264600.v1.1 MD05G1054800.v1.1 MD07G1054400.v1.1 MD10G1062300.v1.1
prunus_persica	Prupe.2G061100_v2.0.a1 Prupe.2G061100_v2.0.a1 Prupe.8G083400_v2.0.a1 Prupe.8G083400_v2.0.a1
pyrus_communis	pycom02g22620 pycom05g04500 pycom07g04220
rosa_chinensis	RchiOBHm_Chr6g0268271 RchiOBHm_Chr6g0268301
rosa_laevigata	RLG00000013919 RLG00000013921
rosa_multiflora	Rmu_sc0009812.1_g000006 Rmu_sc0010202.1_g000007 Rmu_sc0010202.1_g000010
rosa_roxburghii	Rroxscaffold_7G00199870 Rroxscaffold_7G00199910
rosa_rugosa	Rorug06G0040400 Rorug06G0040400
rosa_samantha	Rh6AG160400 Rh6BG164500 Rh6BG164700 Rh6CG153700 Rh6CG153800 Rh6DG150200 Rh6DG150500
rosa_wichuraiana	Rw6G013860 Rw6G013870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	758
Acc36I	ACCTGC	1 cut(s)	874
AccB7I	CCANNNNNTGG	2 cut(s)	201, 876
AccIII	TCCGGA	1 cut(s)	852
AclWI	GGATC	3 cut(s)	186, 452, 650
AcsI	RAATTY	2 cut(s)	205, 557
AcyI	GRCGYC	1 cut(s)	755
AfaI	GTAC	1 cut(s)	281
AfiI	CCNNNNNNNGG	4 cut(s)	11, 201, 605, 876
AflIII	ACRYGT	1 cut(s)	220
AgsI	TTSAA	4 cut(s)	521, 728, 775, 788
AjnI	CCWGG	1 cut(s)	702
AjuI	GAANNNNNNNTTGG	2 cut(s)	111, 143
AluBI	AGCT	3 cut(s)	199, 256, 647
AluI	AGCT	3 cut(s)	199, 256, 647
Alw26I	GTCTC	1 cut(s)	45
AlwI	GGATC	3 cut(s)	186, 452, 650
Ama87I	CYCGRG	1 cut(s)	764
Aor13HI	TCCGGA	1 cut(s)	852
AoxI	GGCC	2 cut(s)	231, 699
ApeKI	GCWGC	3 cut(s)	101, 611, 614
ApoI	RAATTY	2 cut(s)	205, 557
AspLEI	GCGC	2 cut(s)	30, 101
AspS9I	GGNCC	3 cut(s)	700, 823, 855
AsuHPI	GGTGA	2 cut(s)	181, 518
AvaI	CYCGRG	1 cut(s)	764
AvaII	GGWCC	2 cut(s)	823, 855
BbsI	GAAGAC	1 cut(s)	758
BbvI	GCAGC	3 cut(s)	88, 598, 626
BccI	CCATC	3 cut(s)	77, 344, 711
BceAI	ACGGC	1 cut(s)	589
BciT130I	CCWGG	1 cut(s)	704
BcoDI	GTCTC	1 cut(s)	45
BfaI	CTAG	5 cut(s)	140, 272, 359, 383, 471
BfmI	CTRYAG	1 cut(s)	612
BfuAI	ACCTGC	1 cut(s)	874
BglII	AGATCT	2 cut(s)	274, 409
BisI	GCNGC	3 cut(s)	102, 612, 615
BlpI	GCTNAGC	1 cut(s)	481
BlsI	GCNGC	3 cut(s)	103, 613, 616
Bme1390I	CCNGG	1 cut(s)	704
Bme18I	GGWCC	2 cut(s)	823, 855
BmeT110I	CYCGRG	1 cut(s)	764
BmgT120I	GGNCC	3 cut(s)	700, 823, 855
BmrFI	CCNGG	1 cut(s)	704
BmrI	ACTGGG	1 cut(s)	168
BmsI	GCATC	1 cut(s)	585
BmuI	ACTGGG	1 cut(s)	168
BpiI	GAAGAC	1 cut(s)	758
BplI	GAGNNNNNCTC	2 cut(s)	165, 197
Bpu1102I	GCTNAGC	1 cut(s)	481
BpuEI	CTTGAG	1 cut(s)	650
BsaHI	GRCGYC	1 cut(s)	755
BsaI	GGTCTC	1 cut(s)	45
BsaJI	CCNNGG	1 cut(s)	702
BsaWI	WCCGGW	2 cut(s)	314, 852
Bsc4I	CCNNNNNNNGG	4 cut(s)	11, 201, 605, 876
Bse1I	ACTGG	3 cut(s)	5, 163, 659
BseAI	TCCGGA	1 cut(s)	852
BseBI	CCWGG	1 cut(s)	704
BseDI	CCNNGG	1 cut(s)	702
BseGI	GGATG	3 cut(s)	349, 355, 658
BseLI	CCNNNNNNNGG	4 cut(s)	11, 201, 605, 876
BseMII	CTCAG	1 cut(s)	669
BseNI	ACTGG	3 cut(s)	5, 163, 659
BseXI	GCAGC	3 cut(s)	88, 598, 626
BshFI	GGCC	2 cut(s)	233, 701
BsiHKCI	CYCGRG	1 cut(s)	764
BsiSI	CCGG	2 cut(s)	315, 853
BslI	CCNNNNNNNGG	4 cut(s)	11, 201, 605, 876
BsmAI	GTCTC	1 cut(s)	45
BsmI	GAATGC	1 cut(s)	723
BsnI	GGCC	2 cut(s)	233, 701
Bso31I	GGTCTC	1 cut(s)	45
BsoBI	CYCGRG	1 cut(s)	764
Bsp13I	TCCGGA	1 cut(s)	852
Bsp143I	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
Bsp1720I	GCTNAGC	1 cut(s)	481
BspANI	GGCC	2 cut(s)	233, 701
BspCNI	CTCAG	1 cut(s)	670
BspEI	TCCGGA	1 cut(s)	852
BspMAI	CTGCAG	1 cut(s)	616
BspMI	ACCTGC	1 cut(s)	874
BspPI	GGATC	3 cut(s)	186, 452, 650
BspTNI	GGTCTC	1 cut(s)	45
BsrI	ACTGG	3 cut(s)	5, 163, 659
BssECI	CCNNGG	1 cut(s)	702
BssMI	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
BssNI	GRCGYC	1 cut(s)	755
Bst2UI	CCWGG	1 cut(s)	704
Bst4CI	ACNGT	4 cut(s)	245, 335, 697, 739
Bst6I	CTCTTC	1 cut(s)	188
BstACI	GRCGYC	1 cut(s)	755
BstC8I	GCNNGC	2 cut(s)	399, 504
BstDEI	CTNAG	3 cut(s)	481, 678, 897
BstF5I	GGATG	3 cut(s)	349, 355, 658
BstHHI	GCGC	2 cut(s)	30, 101
BstKTI	GATC	7 cut(s)	181, 214, 277, 412, 447, 658, 889
BstMAI	GTCTC	1 cut(s)	45
BstMBI	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
BstMWI	GCNNNNNNNGC	2 cut(s)	169, 729
BstNI	CCWGG	1 cut(s)	704
BstNSI	RCATGY	1 cut(s)	224
BstSCI	CCNGG	1 cut(s)	702
BstSFI	CTRYAG	1 cut(s)	612
BstV1I	GCAGC	3 cut(s)	88, 598, 626
BstV2I	GAAGAC	1 cut(s)	758
BstX2I	RGATCY	3 cut(s)	178, 274, 409
BstYI	RGATCY	3 cut(s)	178, 274, 409
BsuRI	GGCC	2 cut(s)	233, 701
BtsCI	GGATG	3 cut(s)	349, 355, 658
BtsIMutI	CAGTG	4 cut(s)	156, 340, 621, 702
BveI	ACCTGC	1 cut(s)	874
Cac8I	GCNNGC	2 cut(s)	399, 504
CfoI	GCGC	2 cut(s)	30, 101
Cfr13I	GGNCC	3 cut(s)	700, 823, 855
Csp6I	GTAC	1 cut(s)	280
CspCI	CAANNNNNGTGG	2 cut(s)	145, 180
CviAII	CATG	3 cut(s)	31, 221, 820
CviQI	GTAC	1 cut(s)	280
DdeI	CTNAG	3 cut(s)	481, 678, 897
DpnI	GATC	7 cut(s)	180, 213, 276, 411, 446, 657, 888
DpnII	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
Eam1104I	CTCTTC	1 cut(s)	188
EarI	CTCTTC	1 cut(s)	188
Eco147I	AGGCCT	1 cut(s)	233
Eco31I	GGTCTC	1 cut(s)	45
Eco47I	GGWCC	2 cut(s)	823, 855
Eco88I	CYCGRG	1 cut(s)	764
EcoRI	GAATTC	1 cut(s)	205
EcoRII	CCWGG	1 cut(s)	702
FaeI	CATG	3 cut(s)	34, 224, 823
FaiI	YATR	6 cut(s)	32, 222, 404, 456, 532, 821
FatI	CATG	3 cut(s)	30, 220, 819
Fnu4HI	GCNGC	3 cut(s)	102, 612, 615
FokI	GGATG	3 cut(s)	356, 362, 665
Fsp4HI	GCNGC	3 cut(s)	102, 612, 615
FspBI	CTAG	5 cut(s)	140, 272, 359, 383, 471
GlaI	GCGC	2 cut(s)	29, 100
GluI	GCNGC	3 cut(s)	102, 612, 615
HaeIII	GGCC	2 cut(s)	233, 701
HapII	CCGG	2 cut(s)	315, 853
HhaI	GCGC	2 cut(s)	30, 101
Hin1I	GRCGYC	1 cut(s)	755
Hin1II	CATG	3 cut(s)	34, 224, 823
Hin6I	GCGC	2 cut(s)	28, 99
HinP1I	GCGC	2 cut(s)	28, 99
HindIII	AAGCTT	2 cut(s)	197, 254
HinfI	GANTC	4 cut(s)	119, 511, 545, 670
HpaII	CCGG	2 cut(s)	315, 853
HphI	GGTGA	2 cut(s)	181, 518
Hpy166II	GTNNAC	2 cut(s)	289, 841
Hpy188I	TCNGA	5 cut(s)	50, 124, 211, 516, 567
Hpy188III	TCNNGA	7 cut(s)	272, 383, 650, 667, 748, 766, 853
Hpy8I	GTNNAC	2 cut(s)	289, 841
HpyAV	CCTTC	1 cut(s)	29
HpyCH4III	ACNGT	4 cut(s)	245, 335, 697, 739
HpyCH4IV	ACGT	1 cut(s)	755
HpyCH4V	TGCA	2 cut(s)	326, 614
HpyF10VI	GCNNNNNNNGC	2 cut(s)	169, 729
HpyF3I	CTNAG	3 cut(s)	481, 678, 897
HpySE526I	ACGT	1 cut(s)	755
Hsp92I	GRCGYC	1 cut(s)	755
Hsp92II	CATG	3 cut(s)	34, 224, 823
HspAI	GCGC	2 cut(s)	28, 99
Kpn2I	TCCGGA	1 cut(s)	852
Kzo9I	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
Lsp1109I	GCAGC	3 cut(s)	88, 598, 626
LweI	GCATC	1 cut(s)	585
MaeI	CTAG	5 cut(s)	140, 272, 359, 383, 471
MaeII	ACGT	1 cut(s)	755
MaeIII	GTNAC	1 cut(s)	583
MalI	GATC	7 cut(s)	180, 213, 276, 411, 446, 657, 888
MboI	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
MboII	GAAGA	4 cut(s)	175, 419, 704, 763
MflI	RGATCY	3 cut(s)	178, 274, 409
MluCI	AATT	3 cut(s)	64, 205, 557
MmeI	TCCRAC	1 cut(s)	109
MnlI	CCTC	8 cut(s)	65, 127, 169, 223, 340, 599, 808, 836
MroI	TCCGGA	1 cut(s)	852
MseI	TTAA	2 cut(s)	168, 831
MslI	CAYNNNNRTG	1 cut(s)	219
MspI	CCGG	2 cut(s)	315, 853
MspR9I	CCNGG	1 cut(s)	704
Mva1269I	GAATGC	1 cut(s)	723
MvaI	CCWGG	1 cut(s)	704
MwoI	GCNNNNNNNGC	2 cut(s)	169, 729
NdeII	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
NlaIII	CATG	3 cut(s)	34, 224, 823
NmuCI	GTSAC	1 cut(s)	583
NspI	RCATGY	1 cut(s)	224
PaeR7I	CTCGAG	1 cut(s)	764
PceI	AGGCCT	1 cut(s)	233
PciI	ACATGT	1 cut(s)	220
PctI	GAATGC	1 cut(s)	723
PfeI	GAWTC	4 cut(s)	119, 511, 545, 670
PflMI	CCANNNNNTGG	2 cut(s)	201, 876
PkrI	GCNGC	3 cut(s)	103, 613, 616
PscI	ACATGT	1 cut(s)	220
Psp6I	CCWGG	1 cut(s)	702
PspGI	CCWGG	1 cut(s)	702
PspPI	GGNCC	3 cut(s)	700, 823, 855
PstI	CTGCAG	1 cut(s)	616
PsuI	RGATCY	3 cut(s)	178, 274, 409
RsaI	GTAC	1 cut(s)	281
RsaNI	GTAC	1 cut(s)	280
RseI	CAYNNNNRTG	1 cut(s)	219
SaqAI	TTAA	2 cut(s)	168, 831
SatI	GCNGC	3 cut(s)	102, 612, 615
Sau3AI	GATC	7 cut(s)	178, 211, 274, 409, 444, 655, 886
Sau96I	GGNCC	3 cut(s)	700, 823, 855
ScrFI	CCNGG	1 cut(s)	704
SfaNI	GCATC	1 cut(s)	585
SfcI	CTRYAG	1 cut(s)	612
Sfr274I	CTCGAG	1 cut(s)	764
SinI	GGWCC	2 cut(s)	823, 855
SlaI	CTCGAG	1 cut(s)	764
SmiMI	CAYNNNNRTG	1 cut(s)	219
SmlI	CTYRAG	2 cut(s)	665, 764
SmoI	CTYRAG	2 cut(s)	665, 764
Sse9I	AATT	3 cut(s)	64, 205, 557
SseBI	AGGCCT	1 cut(s)	233
SspMI	CTAG	5 cut(s)	140, 272, 359, 383, 471
StuI	AGGCCT	1 cut(s)	233
StyD4I	CCNGG	1 cut(s)	702
TaaI	ACNGT	4 cut(s)	245, 335, 697, 739
TaiI	ACGT	1 cut(s)	758
TaqI	TCGA	2 cut(s)	715, 765
TasI	AATT	3 cut(s)	64, 205, 557
TfiI	GAWTC	4 cut(s)	119, 511, 545, 670
Tru1I	TTAA	2 cut(s)	168, 831
Tru9I	TTAA	2 cut(s)	168, 831
TscAI	CASTG	4 cut(s)	163, 340, 628, 702
TseFI	GTSAC	1 cut(s)	583
TseI	GCWGC	3 cut(s)	101, 611, 614
Tsp45I	GTSAC	1 cut(s)	583
TspDTI	ATGAA	2 cut(s)	132, 175
TspGWI	ACGGA	1 cut(s)	231
TspRI	CASTG	4 cut(s)	163, 340, 628, 702
Van91I	CCANNNNNTGG	2 cut(s)	201, 876
VpaK11BI	GGWCC	2 cut(s)	823, 855
XapI	RAATTY	2 cut(s)	205, 557
XbaI	TCTAGA	2 cut(s)	271, 382
XceI	RCATGY	1 cut(s)	224
XcmI	CCANNNNNNNNNTGG	2 cut(s)	599, 817
XhoI	CTCGAG	1 cut(s)	764
XspI	CTAG	5 cut(s)	140, 272, 359, 383, 471
ZraI	GACGTC	1 cut(s)	756

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.