Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010202.1

Orthogroup ID

OG0003235

Physical Location & Seq

Genomic Coordinates Forward (+)

33009 .. 34633

Gene Structure 1625 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010202.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 807 bp

atgccactaatgggtctgggtctttggcgcatggaaaaagatcagatcagacctctcatcatcactgccataaaacttggctatcgccattttgactgcgctggagttttaagttgcccatataatgttgcagcccattacaagaatgaagtagaagttgggaacgcgcttgcagaagcatttcggtctggacttgtcaagagggaggatgtgttcattacctctaaggccaaccatgaacatgttgttgaggcctgcagagacagcctgaagaagcttcagttggagtatctagatctctacttgattcactttcctatagcctctactcatactggagttggtactactggtagtgttttggatgaggataagatgctggacatggacaccacgatatccctggaaagtacctggcatgatatggaaaagcttgtgtctctgggattagttcgaagcattggaatcaggaagcacggaatatgcgctacagctcatacccctctaggaggctctgtggccaacactaaggactttggttcaatttcttgtttggatgatccaatccttaagggtttggctaagaagtatgaaaagagtgcagcacagattgttctcaggtggggaatacaaaggaatatagcagtcattccaaagacctcaaaagttgagagattgaaagagaatctgcaagttcttgatgacttcaagctgagcaaagaggacatggacctcatcaaaaccatagataggaaatacaggaccaatccggcttccaagagttggggcctcgatgtctatgcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00010 ko00040 ko00051 ko00052 ko00561 ko00790 ko00930 ko01100 ko01110 ko01120 ko01130 ko01220 map00010 map00040 map00051 map00052 map00561 map00790 map00930 map01100 map01110 map01120 map01130 map01220

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

268

Amino Acids

29.96

Weight (kDa)

8.18

Isoelectric Point (pI)

26.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003235)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21250 AT2G21250 AT2G21260 AT2G21260
fragaria_vesca	FvH4_2g10630
malus_domestica	MD02G1264100.v1.1 MD02G1264600.v1.1 MD05G1054800.v1.1 MD07G1054400.v1.1 MD10G1062300.v1.1
prunus_persica	Prupe.2G061100_v2.0.a1 Prupe.2G061100_v2.0.a1 Prupe.8G083400_v2.0.a1 Prupe.8G083400_v2.0.a1
pyrus_communis	pycom02g22620 pycom05g04500 pycom07g04220
rosa_chinensis	RchiOBHm_Chr6g0268271 RchiOBHm_Chr6g0268301
rosa_laevigata	RLG00000013919 RLG00000013921
rosa_multiflora	Rmu_sc0009812.1_g000006 Rmu_sc0010202.1_g000007 Rmu_sc0010202.1_g000010
rosa_roxburghii	Rroxscaffold_7G00199870 Rroxscaffold_7G00199910
rosa_rugosa	Rorug06G0040400 Rorug06G0040400
rosa_samantha	Rh6AG160400 Rh6BG164500 Rh6BG164700 Rh6CG153700 Rh6CG153800 Rh6DG150200 Rh6DG150500
rosa_wichuraiana	Rw6G013860 Rw6G013870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	783
AccII	CGCG	1 cut(s)	167
AclWI	GGATC	1 cut(s)	554
AcoI	YGGCCR	1 cut(s)	519
AcuI	CTGAAG	2 cut(s)	263, 290
AfaI	GTAC	2 cut(s)	346, 412
AfiI	CCNNNNNNNGG	4 cut(s)	11, 509, 750, 783
AflII	CTTAAG	1 cut(s)	569
AflIII	ACRYGT	1 cut(s)	241
AgsI	TTSAA	3 cut(s)	543, 679, 709
AjnI	CCWGG	2 cut(s)	402, 413
AjuI	GAANNNNNNNTTGG	4 cut(s)	141, 173, 266, 298
AloI	GAACNNNNNNTCC	2 cut(s)	197, 229
AluBI	AGCT	4 cut(s)	277, 433, 494, 712
AluI	AGCT	4 cut(s)	277, 433, 494, 712
Alw26I	GTCTC	2 cut(s)	255, 444
AlwI	GGATC	1 cut(s)	554
AoxI	GGCC	4 cut(s)	228, 252, 519, 787
ApeKI	GCWGC	2 cut(s)	131, 602
Asp700I	GAANNNNTTC	1 cut(s)	180
AspLEI	GCGC	4 cut(s)	30, 101, 169, 488
AspS9I	GGNCC	3 cut(s)	730, 762, 787
AsuII	TTCGAA	1 cut(s)	454
AvaII	GGWCC	2 cut(s)	730, 762
BalI	TGGCCA	1 cut(s)	521
BbvI	GCAGC	2 cut(s)	143, 614
BcgI	CGANNNNNNTGC	1 cut(s)	782
BciT130I	CCWGG	2 cut(s)	404, 415
BcoDI	GTCTC	2 cut(s)	255, 444
BfaI	CTAG	2 cut(s)	293, 506
BfmI	CTRYAG	3 cut(s)	256, 318, 489
BfrI	CTTAAG	1 cut(s)	569
BglII	AGATCT	1 cut(s)	295
BisI	GCNGC	2 cut(s)	132, 603
BlpI	GCTNAGC	1 cut(s)	713
BlsI	GCNGC	2 cut(s)	133, 604
Bme1390I	CCNGG	2 cut(s)	404, 415
Bme18I	GGWCC	2 cut(s)	730, 762
BmgT120I	GGNCC	3 cut(s)	730, 762, 787
BmiI	GGNNCC	1 cut(s)	788
BmrFI	CCNGG	2 cut(s)	404, 415
BmsI	GCATC	1 cut(s)	366
BpmI	CTGGAG	2 cut(s)	123, 357
Bpu1102I	GCTNAGC	1 cut(s)	713
Bpu14I	TTCGAA	1 cut(s)	454
BsaJI	CCNNGG	1 cut(s)	402
BsaXI	ACNNNNNCTCC	4 cut(s)	197, 227, 501, 531
Bsc4I	CCNNNNNNNGG	4 cut(s)	11, 509, 750, 783
Bse1I	ACTGG	2 cut(s)	340, 355
BseBI	CCWGG	2 cut(s)	404, 415
BseDI	CCNNGG	1 cut(s)	402
BseGI	GGATG	3 cut(s)	214, 370, 562
BseLI	CCNNNNNNNGG	4 cut(s)	11, 509, 750, 783
BseMII	CTCAG	2 cut(s)	631, 704
BseNI	ACTGG	2 cut(s)	340, 355
BseXI	GCAGC	2 cut(s)	143, 614
BsgI	GTGCAG	1 cut(s)	621
Bsh1236I	CGCG	1 cut(s)	167
BshFI	GGCC	4 cut(s)	230, 254, 521, 789
BsiSI	CCGG	1 cut(s)	770
BslI	CCNNNNNNNGG	4 cut(s)	11, 509, 750, 783
BsmAI	GTCTC	2 cut(s)	255, 444
BsnI	GGCC	4 cut(s)	230, 254, 521, 789
Bsp119I	TTCGAA	1 cut(s)	454
Bsp143I	GATC	4 cut(s)	40, 45, 295, 559
Bsp1720I	GCTNAGC	1 cut(s)	713
BspANI	GGCC	4 cut(s)	230, 254, 521, 789
BspCNI	CTCAG	2 cut(s)	630, 705
BspFNI	CGCG	1 cut(s)	167
BspLI	GGNNCC	1 cut(s)	788
BspMAI	CTGCAG	1 cut(s)	260
BspPI	GGATC	1 cut(s)	554
BspT104I	TTCGAA	1 cut(s)	454
BspTI	CTTAAG	1 cut(s)	569
BsrI	ACTGG	2 cut(s)	340, 355
BssECI	CCNNGG	1 cut(s)	402
BssMI	GATC	4 cut(s)	40, 45, 295, 559
Bst2UI	CCWGG	2 cut(s)	404, 415
BstAFI	CTTAAG	1 cut(s)	569
BstBI	TTCGAA	1 cut(s)	454
BstC8I	GCNNGC	2 cut(s)	171, 256
BstDEI	CTNAG	5 cut(s)	225, 528, 582, 617, 713
BstENI	CCTNNNNNAGG	1 cut(s)	507
BstF5I	GGATG	3 cut(s)	214, 370, 562
BstFNI	CGCG	1 cut(s)	167
BstHHI	GCGC	4 cut(s)	30, 101, 169, 488
BstKTI	GATC	4 cut(s)	43, 48, 298, 562
BstMAI	GTCTC	2 cut(s)	255, 444
BstMBI	GATC	4 cut(s)	40, 45, 295, 559
BstMWI	GCNNNNNNNGC	1 cut(s)	264
BstNI	CCWGG	2 cut(s)	404, 415
BstNSI	RCATGY	1 cut(s)	245
BstSCI	CCNGG	2 cut(s)	402, 413
BstSFI	CTRYAG	3 cut(s)	256, 318, 489
BstUI	CGCG	1 cut(s)	167
BstV1I	GCAGC	2 cut(s)	143, 614
BstX2I	RGATCY	1 cut(s)	295
BstYI	RGATCY	1 cut(s)	295
BsuRI	GGCC	4 cut(s)	230, 254, 521, 789
BtsCI	GGATG	3 cut(s)	214, 370, 562
BtsI	GCAGTG	1 cut(s)	63
BtsIMutI	CAGTG	1 cut(s)	63
Cac8I	GCNNGC	2 cut(s)	171, 256
CfoI	GCGC	4 cut(s)	30, 101, 169, 488
Cfr13I	GGNCC	3 cut(s)	730, 762, 787
Csp6I	GTAC	2 cut(s)	345, 411
CviAII	CATG	6 cut(s)	31, 236, 242, 385, 419, 727
CviQI	GTAC	2 cut(s)	345, 411
DdeI	CTNAG	5 cut(s)	225, 528, 582, 617, 713
DpnI	GATC	4 cut(s)	42, 47, 297, 561
DpnII	GATC	4 cut(s)	40, 45, 295, 559
EaeI	YGGCCR	1 cut(s)	519
Eco147I	AGGCCT	1 cut(s)	254
Eco32I	GATATC	1 cut(s)	399
Eco47I	GGWCC	2 cut(s)	730, 762
Eco57I	CTGAAG	2 cut(s)	263, 290
EcoNI	CCTNNNNNAGG	1 cut(s)	507
EcoO109I	RGGNCCY	1 cut(s)	787
EcoRII	CCWGG	2 cut(s)	402, 413
EcoRV	GATATC	1 cut(s)	399
EcoT22I	ATGCAT	1 cut(s)	805
FaeI	CATG	6 cut(s)	34, 239, 245, 388, 422, 730
FatI	CATG	6 cut(s)	30, 235, 241, 384, 418, 726
Fnu4HI	GCNGC	2 cut(s)	132, 603
FokI	GGATG	3 cut(s)	221, 377, 569
Fsp4HI	GCNGC	2 cut(s)	132, 603
FspBI	CTAG	2 cut(s)	293, 506
GlaI	GCGC	4 cut(s)	29, 100, 168, 487
GluI	GCNGC	2 cut(s)	132, 603
GsuI	CTGGAG	2 cut(s)	123, 357
HaeIII	GGCC	4 cut(s)	230, 254, 521, 789
HapII	CCGG	1 cut(s)	770
HhaI	GCGC	4 cut(s)	30, 101, 169, 488
Hin1II	CATG	6 cut(s)	34, 239, 245, 388, 422, 730
Hin6I	GCGC	4 cut(s)	28, 99, 167, 486
HinP1I	GCGC	4 cut(s)	28, 99, 167, 486
HindIII	AAGCTT	2 cut(s)	275, 431
HinfI	GANTC	3 cut(s)	307, 465, 685
HpaII	CCGG	1 cut(s)	770
Hpy188I	TCNGA	2 cut(s)	45, 50
Hpy188III	TCNNGA	5 cut(s)	189, 199, 293, 469, 698
HpyCH4V	TGCA	6 cut(s)	131, 173, 258, 602, 691, 803
HpyF10VI	GCNNNNNNNGC	1 cut(s)	264
HpyF3I	CTNAG	5 cut(s)	225, 528, 582, 617, 713
Hsp92II	CATG	6 cut(s)	34, 239, 245, 388, 422, 730
HspAI	GCGC	4 cut(s)	28, 99, 167, 486
Kzo9I	GATC	4 cut(s)	40, 45, 295, 559
Lsp1109I	GCAGC	2 cut(s)	143, 614
LweI	GCATC	1 cut(s)	366
MaeI	CTAG	2 cut(s)	293, 506
MalI	GATC	4 cut(s)	42, 47, 297, 561
MboI	GATC	4 cut(s)	40, 45, 295, 559
MboII	GAAGA	1 cut(s)	283
MflI	RGATCY	1 cut(s)	295
MlsI	TGGCCA	1 cut(s)	521
MluCI	AATT	1 cut(s)	543
MluNI	TGGCCA	1 cut(s)	521
MmeI	TCCRAC	1 cut(s)	264
Mox20I	TGGCCA	1 cut(s)	521
Mph1103I	ATGCAT	1 cut(s)	805
MroXI	GAANNNNTTC	1 cut(s)	180
MscI	TGGCCA	1 cut(s)	521
MseI	TTAA	2 cut(s)	110, 570
MslI	CAYNNNNRTG	1 cut(s)	240
Msp20I	TGGCCA	1 cut(s)	521
MspCI	CTTAAG	1 cut(s)	569
MspI	CCGG	1 cut(s)	770
MspR9I	CCNGG	2 cut(s)	404, 415
MvaI	CCWGG	2 cut(s)	404, 415
MvnI	CGCG	1 cut(s)	167
MwoI	GCNNNNNNNGC	1 cut(s)	264
NdeII	GATC	4 cut(s)	40, 45, 295, 559
NlaIII	CATG	6 cut(s)	34, 239, 245, 388, 422, 730
NlaIV	GGNNCC	1 cut(s)	788
NsiI	ATGCAT	1 cut(s)	805
NspI	RCATGY	1 cut(s)	245
NspV	TTCGAA	1 cut(s)	454
PceI	AGGCCT	1 cut(s)	254
PciI	ACATGT	1 cut(s)	241
PdmI	GAANNNNTTC	1 cut(s)	180
PfeI	GAWTC	3 cut(s)	307, 465, 685
PflMI	CCANNNNNTGG	1 cut(s)	783
PkrI	GCNGC	2 cut(s)	133, 604
PscI	ACATGT	1 cut(s)	241
Psp6I	CCWGG	2 cut(s)	402, 413
PspGI	CCWGG	2 cut(s)	402, 413
PspN4I	GGNNCC	1 cut(s)	788
PspPI	GGNCC	3 cut(s)	730, 762, 787
PstI	CTGCAG	1 cut(s)	260
PsuI	RGATCY	1 cut(s)	295
RsaI	GTAC	2 cut(s)	346, 412
RsaNI	GTAC	2 cut(s)	345, 411
RseI	CAYNNNNRTG	1 cut(s)	240
SaqAI	TTAA	2 cut(s)	110, 570
SatI	GCNGC	2 cut(s)	132, 603
Sau3AI	GATC	4 cut(s)	40, 45, 295, 559
Sau96I	GGNCC	3 cut(s)	730, 762, 787
ScrFI	CCNGG	2 cut(s)	404, 415
SfaNI	GCATC	1 cut(s)	366
SfcI	CTRYAG	3 cut(s)	256, 318, 489
SfuI	TTCGAA	1 cut(s)	454
SinI	GGWCC	2 cut(s)	730, 762
SmiMI	CAYNNNNRTG	1 cut(s)	240
SmlI	CTYRAG	1 cut(s)	569
SmoI	CTYRAG	1 cut(s)	569
Sse9I	AATT	1 cut(s)	543
SseBI	AGGCCT	1 cut(s)	254
SspMI	CTAG	2 cut(s)	293, 506
StuI	AGGCCT	1 cut(s)	254
StyD4I	CCNGG	2 cut(s)	402, 413
TaqI	TCGA	2 cut(s)	454, 792
TaqII	GACCGA	1 cut(s)	174
TasI	AATT	1 cut(s)	543
TfiI	GAWTC	3 cut(s)	307, 465, 685
Tru1I	TTAA	2 cut(s)	110, 570
Tru9I	TTAA	2 cut(s)	110, 570
TscAI	CASTG	1 cut(s)	70
TseI	GCWGC	2 cut(s)	131, 602
TspDTI	ATGAA	4 cut(s)	162, 205, 252, 606
TspGWI	ACGGA	1 cut(s)	492
TspRI	CASTG	1 cut(s)	70
Van91I	CCANNNNNTGG	1 cut(s)	783
Vha464I	CTTAAG	1 cut(s)	569
VpaK11BI	GGWCC	2 cut(s)	730, 762
XagI	CCTNNNNNAGG	1 cut(s)	507
XbaI	TCTAGA	1 cut(s)	292
XceI	RCATGY	1 cut(s)	245
XcmI	CCANNNNNNNNNTGG	1 cut(s)	400
XmnI	GAANNNNTTC	1 cut(s)	180
XspI	CTAG	2 cut(s)	293, 506
Zsp2I	ATGCAT	1 cut(s)	805

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.