Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0020979.1

Orthogroup ID

OG0001779

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 512

Gene Structure 512 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0020979.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

ccacaggggtggaagcctggtgatgaccctacccaagacccaacttgtgcagcaatgtttaaggagctgtgggatgagatatctaatctgaagaagagggacgaggaatccaagcagccagagcagggtttagctatggtgaccaccacctcaaactcttggttgacaagtatggactgggaccaagcttacagttcagtcattcagctaaaggacaaatatacacaactagctgtcagggcatccaagttcgaagaacagatgcagcaagcttctcaaactttgtctggaatggaggtatgcagcatgggaattgcccccatagactttgttctttctcgtaattacacgtatagtggtagtgtccatttagtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00240 ko01100 map00240 map01100

Pfam Domains

Protein Families

AA_kinase

Protein Analysis

125

Amino Acids

14.09

Weight (kDa)

4.64

Isoelectric Point (pI)

35.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001779)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G51330 AT5G51330
fragaria_vesca	FvH4_1g24020 FvH4_1g24020 FvH4_7g27150 FvH4_7g27150 FvH4_7g27150 FvH4_7g27150
malus_domestica	MD01G1180700.v1.1 MD07G1251100.v1.1
prunus_persica	Prupe.2G133400_v2.0.a1 Prupe.2G133400_v2.0.a1 Prupe.2G274700_v2.0.a1
pyrus_communis	pycom01g19090
rosa_chinensis	RchiOBHm_Chr1g0373991 RchiOBHm_Chr2g0120161
rosa_laevigata	RLG00000016013 RLG00000018527 RLG00000026788
rosa_multiflora	Rmu_co8084184.1_g000001 Rmu_co8202680.1_g000001 Rmu_co8293435.1_g000001 Rmu_co8298741.1_g000001 Rmu_sc0005304.1_g000004 Rmu_sc0008322.1_g000013 Rmu_sc0015468.1_g000001 Rmu_sc0015469.1_g000002 Rmu_sc0020978.1_g000001 Rmu_sc0020979.1_g000001
rosa_roxburghii	Rroxscaffold_2G00123660 Rroxscaffold_4G00283840 Rroxscaffold_4G00283860
rosa_rugosa	Rorug01G0380000 Rorug01G0380100 Rorug02G0227300
rosa_samantha	Rh1AG390500 Rh1BG354600 Rh1CG367700 Rh1DG385300 Rh2AG283900 Rh2BG295200 Rh2CG272600 Rh2DG044200 Rh2DG308900
rosa_wichuraiana	Rw1G034470 Rw2G003810 Rw2G022740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	110
AfiI	CCNNNNNNNGG	1 cut(s)	125
AflIII	ACRYGT	1 cut(s)	348
AjnI	CCWGG	1 cut(s)	16
AleI	CACNNNNGTG	1 cut(s)	7
AluBI	AGCT	6 cut(s)	67, 134, 188, 208, 233, 272
AluI	AGCT	6 cut(s)	67, 134, 188, 208, 233, 272
ApeKI	GCWGC	4 cut(s)	50, 115, 265, 303
AspS9I	GGNCC	1 cut(s)	181
AsuHPI	GGTGA	2 cut(s)	32, 151
AsuII	TTCGAA	1 cut(s)	252
AvaII	GGWCC	1 cut(s)	181
BbvI	GCAGC	4 cut(s)	62, 127, 277, 315
BciT130I	CCWGG	1 cut(s)	18
BfaI	CTAG	1 cut(s)	230
BisI	GCNGC	4 cut(s)	51, 116, 266, 304
BlsI	GCNGC	4 cut(s)	52, 117, 267, 305
Bme1390I	CCNGG	1 cut(s)	18
Bme18I	GGWCC	1 cut(s)	181
BmgT120I	GGNCC	1 cut(s)	181
BmiI	GGNNCC	1 cut(s)	182
BmrFI	CCNGG	1 cut(s)	18
BmrI	ACTGGG	1 cut(s)	187
BmsI	GCATC	2 cut(s)	251, 252
BmuI	ACTGGG	1 cut(s)	187
Bpu14I	TTCGAA	1 cut(s)	252
BsaAI	YACGTR	1 cut(s)	351
Bsc4I	CCNNNNNNNGG	1 cut(s)	125
Bse1I	ACTGG	1 cut(s)	182
Bse3DI	GCAATG	1 cut(s)	60
BseBI	CCWGG	1 cut(s)	18
BseGI	GGATG	2 cut(s)	79, 242
BseLI	CCNNNNNNNGG	1 cut(s)	125
BseMI	GCAATG	1 cut(s)	60
BseNI	ACTGG	1 cut(s)	182
BseXI	GCAGC	4 cut(s)	62, 127, 277, 315
BsgI	GTGCAG	1 cut(s)	69
BslFI	GGGAC	2 cut(s)	113, 194
BslI	CCNNNNNNNGG	1 cut(s)	125
BsmFI	GGGAC	2 cut(s)	113, 194
Bsp119I	TTCGAA	1 cut(s)	252
BspLI	GGNNCC	1 cut(s)	182
BspT104I	TTCGAA	1 cut(s)	252
BsrDI	GCAATG	1 cut(s)	60
BsrI	ACTGG	1 cut(s)	182
Bst2UI	CCWGG	1 cut(s)	18
Bst4CI	ACNGT	1 cut(s)	194
Bst6I	CTCTTC	1 cut(s)	89
BstBAI	YACGTR	1 cut(s)	351
BstBI	TTCGAA	1 cut(s)	252
BstC8I	GCNNGC	1 cut(s)	270
BstEII	GGTNACC	1 cut(s)	139
BstF5I	GGATG	2 cut(s)	79, 242
BstMWI	GCNNNNNNNGC	2 cut(s)	121, 239
BstNI	CCWGG	1 cut(s)	18
BstPI	GGTNACC	1 cut(s)	139
BstSCI	CCNGG	1 cut(s)	16
BstV1I	GCAGC	4 cut(s)	62, 127, 277, 315
BstXI	CCANNNNNNTGG	1 cut(s)	9
BtsCI	GGATG	2 cut(s)	79, 242
Cac8I	GCNNGC	1 cut(s)	270
Cfr13I	GGNCC	1 cut(s)	181
CviAII	CATG	1 cut(s)	307
CviJI	RGCY	8 cut(s)	16, 67, 118, 134, 188, 208, 233, 272
CviKI_1	RGCY	8 cut(s)	16, 67, 118, 134, 188, 208, 233, 272
Eam1104I	CTCTTC	1 cut(s)	89
EarI	CTCTTC	1 cut(s)	89
Eco32I	GATATC	1 cut(s)	81
Eco47I	GGWCC	1 cut(s)	181
Eco57I	CTGAAG	1 cut(s)	110
Eco91I	GGTNACC	1 cut(s)	139
EcoO65I	GGTNACC	1 cut(s)	139
EcoRII	CCWGG	1 cut(s)	16
EcoRV	GATATC	1 cut(s)	81
FaeI	CATG	1 cut(s)	310
FaiI	YATR	8 cut(s)	137, 173, 222, 301, 308, 323, 354, 376
FaqI	GGGAC	2 cut(s)	113, 194
FatI	CATG	1 cut(s)	306
Fnu4HI	GCNGC	4 cut(s)	51, 116, 266, 304
FokI	GGATG	2 cut(s)	86, 229
Fsp4HI	GCNGC	4 cut(s)	51, 116, 266, 304
FspBI	CTAG	1 cut(s)	230
GluI	GCNGC	4 cut(s)	51, 116, 266, 304
Hin1II	CATG	1 cut(s)	310
HincII	GTYRAC	1 cut(s)	165
HindII	GTYRAC	1 cut(s)	165
HindIII	AAGCTT	2 cut(s)	186, 270
HinfI	GANTC	1 cut(s)	107
HphI	GGTGA	2 cut(s)	32, 151
Hpy166II	GTNNAC	1 cut(s)	165
Hpy188I	TCNGA	1 cut(s)	90
Hpy188III	TCNNGA	1 cut(s)	288
Hpy8I	GTNNAC	1 cut(s)	165
HpyCH4III	ACNGT	1 cut(s)	194
HpyCH4IV	ACGT	1 cut(s)	350
HpyCH4V	TGCA	3 cut(s)	50, 265, 303
HpyF10VI	GCNNNNNNNGC	2 cut(s)	121, 239
HpySE526I	ACGT	1 cut(s)	350
Hsp92II	CATG	1 cut(s)	310
LmnI	GCTCC	1 cut(s)	64
LpnPI	CCDG	7 cut(s)	3, 30, 110, 132, 163, 223, 273
Lsp1109I	GCAGC	4 cut(s)	62, 127, 277, 315
LweI	GCATC	2 cut(s)	251, 252
MaeI	CTAG	1 cut(s)	230
MaeII	ACGT	1 cut(s)	350
MaeIII	GTNAC	1 cut(s)	139
MboII	GAAGA	3 cut(s)	103, 106, 266
MluCI	AATT	2 cut(s)	312, 343
MnlI	CCTC	4 cut(s)	90, 97, 160, 289
MseI	TTAA	1 cut(s)	60
MslI	CAYNNNNRTG	1 cut(s)	7
MspR9I	CCNGG	1 cut(s)	18
MvaI	CCWGG	1 cut(s)	18
MwoI	GCNNNNNNNGC	2 cut(s)	121, 239
NlaIII	CATG	1 cut(s)	310
NlaIV	GGNNCC	1 cut(s)	182
NmuCI	GTSAC	1 cut(s)	139
NspV	TTCGAA	1 cut(s)	252
OliI	CACNNNNGTG	1 cut(s)	7
PfeI	GAWTC	1 cut(s)	107
PkrI	GCNGC	4 cut(s)	52, 117, 267, 305
Ppu21I	YACGTR	1 cut(s)	351
Psp6I	CCWGG	1 cut(s)	16
PspEI	GGTNACC	1 cut(s)	139
PspGI	CCWGG	1 cut(s)	16
PspN4I	GGNNCC	1 cut(s)	182
PspPI	GGNCC	1 cut(s)	181
RseI	CAYNNNNRTG	1 cut(s)	7
SaqAI	TTAA	1 cut(s)	60
SatI	GCNGC	4 cut(s)	51, 116, 266, 304
Sau96I	GGNCC	1 cut(s)	181
ScrFI	CCNGG	1 cut(s)	18
SetI	ASST	9 cut(s)	69, 136, 152, 190, 210, 235, 274, 300, 353
SfaNI	GCATC	2 cut(s)	251, 252
SfuI	TTCGAA	1 cut(s)	252
SinI	GGWCC	1 cut(s)	181
SmiMI	CAYNNNNRTG	1 cut(s)	7
Sse9I	AATT	2 cut(s)	312, 343
SspMI	CTAG	1 cut(s)	230
StyD4I	CCNGG	1 cut(s)	16
TaaI	ACNGT	1 cut(s)	194
TaiI	ACGT	1 cut(s)	353
TaqI	TCGA	1 cut(s)	252
TasI	AATT	2 cut(s)	312, 343
TfiI	GAWTC	1 cut(s)	107
Tru1I	TTAA	1 cut(s)	60
Tru9I	TTAA	1 cut(s)	60
TseFI	GTSAC	1 cut(s)	139
TseI	GCWGC	4 cut(s)	50, 115, 265, 303
Tsp45I	GTSAC	1 cut(s)	139
VpaK11BI	GGWCC	1 cut(s)	181
XspI	CTAG	1 cut(s)	230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.