Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0021229.1

Orthogroup ID

OG0002300

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 2570

Gene Structure 2570 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0021229.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 560 bp

atggtttgtgaagacgacgagcctgatgtcgagataggcatacctgctgttatgcttcccaacaaaattggtgaaatcttggaaaatggattaacgaacaattccatagaacttttcaagatggtttgtgaagacgatgagcctgatgtcgagataggcatacctgctgttatgcttcccaacaaaattgtttctgtgcagctatactctccattgcgtccactggttgacattgcagaagtatttttatggcttatggatgttggtaccagcttatttgcttcttgttggtctgcatggactgcaagagaagcagctattgagcatgacaagctattgaaggatgcttctgacgagtctccacatgtggaaggtgaaagtgccagtcctctagtggagattagcaccatggcagcaattctctttgttgtgattgcttcatgcttcttggttatgttttacaaacttatgtccttctggttcatcgagattctggtggttttgttttgcattggtgggatagagggcctacagatttgcttggtggccttgctatcatg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005764 GO:0005765 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005798 GO:0012505 GO:0016020 GO:0016021 GO:0030176 GO:0030660 GO:0031090 GO:0031224 GO:0031227 GO:0031410 GO:0031982 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044433 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0071458 GO:0071556 GO:0097708 GO:0098552 GO:0098553 GO:0098554 GO:0098562 GO:0098588 GO:0098805 GO:0098827 GO:0098852

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PA Peptidase_A22B

Protein Analysis

186

Amino Acids

20.48

Weight (kDa)

4.05

Isoelectric Point (pI)

54.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002300)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G01650 AT1G01650 AT1G01650 AT1G01650
fragaria_vesca	FvH4_7g14350 FvH4_7g14350 FvH4_7g14350 FvH4_7g14350 FvH4_7g14350
malus_domestica	MD01G1061500.v1.1 MD07G1136600.v1.1
prunus_persica	Prupe.2G171000_v2.0.a1 Prupe.2G171000_v2.0.a1
pyrus_communis	pycom01g09170 pycom07g13430
rosa_chinensis	RchiOBHm_Chr1g0355371
rosa_laevigata	RLG00000028134 RLG00000028139 RLG00000028145 RLG00000028149
rosa_multiflora	Rmu_sc0004484.1_g000010 Rmu_sc0021229.1_g000001
rosa_roxburghii	Rroxscaffold_4G00300080 Rroxscaffold_4G00300120 Rroxscaffold_4G00300280 Rroxscaffold_4G00300370 Rroxscaffold_4G00300460
rosa_rugosa	Rorug01G0246900
rosa_samantha	Rh1AG259400 Rh1AG259500 Rh1AG259800 Rh1AG260300 Rh1AG260900 Rh1BG229000 Rh1BG229200 Rh1CG243400 Rh1CG243500 Rh1DG256900
rosa_wichuraiana	Rw1G020180 Rw1G022870 Rw1G022900 Rw1G022920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	52, 172
Acc65I	GGTACC	1 cut(s)	266
AccB1I	GGYRCC	1 cut(s)	266
AfaI	GTAC	1 cut(s)	268
AflIII	ACRYGT	1 cut(s)	364
AgsI	TTSAA	2 cut(s)	118, 340
AluBI	AGCT	4 cut(s)	202, 273, 317, 334
AluI	AGCT	4 cut(s)	202, 273, 317, 334
Alw26I	GTCTC	1 cut(s)	363
AoxI	GGCC	2 cut(s)	526, 546
ApeKI	GCWGC	3 cut(s)	199, 314, 413
Asp718I	GGTACC	1 cut(s)	266
AspS9I	GGNCC	1 cut(s)	526
AsuHPI	GGTGA	2 cut(s)	83, 386
BanI	GGYRCC	1 cut(s)	266
BbsI	GAAGAC	2 cut(s)	18, 138
BbvI	GCAGC	3 cut(s)	211, 326, 425
BccI	CCATC	1 cut(s)	115
BcoDI	GTCTC	1 cut(s)	363
BfaI	CTAG	1 cut(s)	392
BfmI	CTRYAG	1 cut(s)	530
BfuAI	ACCTGC	2 cut(s)	52, 172
BisI	GCNGC	3 cut(s)	200, 315, 414
BlsI	GCNGC	3 cut(s)	201, 316, 415
BmgT120I	GGNCC	1 cut(s)	526
BmiI	GGNNCC	1 cut(s)	268
BmsI	GCATC	1 cut(s)	334
BpiI	GAAGAC	2 cut(s)	18, 138
BsaJI	CCNNGG	1 cut(s)	408
Bse1I	ACTGG	2 cut(s)	228, 384
Bse3DI	GCAATG	2 cut(s)	212, 231
BseDI	CCNNGG	1 cut(s)	408
BseGI	GGATG	2 cut(s)	265, 349
BseMI	GCAATG	2 cut(s)	212, 231
BseNI	ACTGG	2 cut(s)	228, 384
BseXI	GCAGC	3 cut(s)	211, 326, 425
BsgI	GTGCAG	1 cut(s)	218
BshFI	GGCC	2 cut(s)	528, 548
BshNI	GGYRCC	1 cut(s)	266
BsmAI	GTCTC	1 cut(s)	363
BsnI	GGCC	2 cut(s)	528, 548
Bsp19I	CCATGG	1 cut(s)	408
BspANI	GGCC	2 cut(s)	528, 548
BspLI	GGNNCC	1 cut(s)	268
BspMI	ACCTGC	2 cut(s)	52, 172
BspT107I	GGYRCC	1 cut(s)	266
BsrDI	GCAATG	2 cut(s)	212, 231
BsrI	ACTGG	2 cut(s)	228, 384
BssECI	CCNNGG	1 cut(s)	408
BssT1I	CCWWGG	1 cut(s)	408
BstAPI	GCANNNNNTGC	1 cut(s)	302
BstDSI	CCRYGG	1 cut(s)	408
BstF5I	GGATG	2 cut(s)	265, 349
BstMAI	GTCTC	1 cut(s)	363
BstMWI	GCNNNNNNNGC	3 cut(s)	302, 311, 331
BstNSI	RCATGY	1 cut(s)	368
BstSFI	CTRYAG	1 cut(s)	530
BstV1I	GCAGC	3 cut(s)	211, 326, 425
BstV2I	GAAGAC	2 cut(s)	18, 138
BsuRI	GGCC	2 cut(s)	528, 548
BtgI	CCRYGG	1 cut(s)	408
BtsCI	GGATG	2 cut(s)	265, 349
BtsIMutI	CAGTG	1 cut(s)	221
BveI	ACCTGC	2 cut(s)	52, 172
Cfr13I	GGNCC	1 cut(s)	526
CseI	GACGC	1 cut(s)	206
Csp6I	GTAC	1 cut(s)	267
CviAII	CATG	6 cut(s)	297, 326, 365, 409, 441, 558
CviJI	RGCY	9 cut(s)	22, 142, 202, 253, 273, 317, 334, 528, 548
CviKI_1	RGCY	9 cut(s)	22, 142, 202, 253, 273, 317, 334, 528, 548
CviQI	GTAC	1 cut(s)	267
Eco130I	CCWWGG	1 cut(s)	408
EcoO109I	RGGNCCY	1 cut(s)	526
EcoT14I	CCWWGG	1 cut(s)	408
ErhI	CCWWGG	1 cut(s)	408
FaeI	CATG	5 cut(s)	300, 329, 368, 412, 444
FatI	CATG	5 cut(s)	296, 325, 364, 408, 440
Fnu4HI	GCNGC	3 cut(s)	200, 315, 414
FokI	GGATG	2 cut(s)	272, 356
Fsp4HI	GCNGC	3 cut(s)	200, 315, 414
FspBI	CTAG	1 cut(s)	392
GluI	GCNGC	3 cut(s)	200, 315, 414
HaeIII	GGCC	2 cut(s)	528, 548
HgaI	GACGC	1 cut(s)	206
Hin1II	CATG	5 cut(s)	300, 329, 368, 412, 444
HincII	GTYRAC	1 cut(s)	229
HindII	GTYRAC	1 cut(s)	229
HinfI	GANTC	2 cut(s)	356, 490
HphI	GGTGA	2 cut(s)	83, 386
Hpy166II	GTNNAC	2 cut(s)	221, 229
Hpy188I	TCNGA	1 cut(s)	352
Hpy188III	TCNNGA	4 cut(s)	31, 118, 151, 487
Hpy8I	GTNNAC	2 cut(s)	221, 229
Hpy99I	CGWCG	1 cut(s)	20
HpyAV	CCTTC	3 cut(s)	334, 365, 484
HpyCH4V	TGCA	5 cut(s)	199, 236, 296, 305, 510
HpyF10VI	GCNNNNNNNGC	3 cut(s)	302, 311, 331
Hsp92II	CATG	5 cut(s)	300, 329, 368, 412, 444
KpnI	GGTACC	1 cut(s)	270
LpnPI	CCDG	9 cut(s)	36, 57, 156, 177, 209, 283, 397, 463, 479
Lsp1109I	GCAGC	3 cut(s)	211, 326, 425
LweI	GCATC	1 cut(s)	334
MaeI	CTAG	1 cut(s)	392
MboII	GAAGA	2 cut(s)	23, 143
MluCI	AATT	4 cut(s)	66, 100, 186, 417
MlyI	GAGTC	1 cut(s)	365
MnlI	CCTC	2 cut(s)	399, 517
MseI	TTAA	1 cut(s)	92
MwoI	GCNNNNNNNGC	3 cut(s)	302, 311, 331
NcoI	CCATGG	1 cut(s)	408
NlaIII	CATG	5 cut(s)	300, 329, 368, 412, 444
NlaIV	GGNNCC	1 cut(s)	268
NspI	RCATGY	1 cut(s)	368
PciI	ACATGT	1 cut(s)	364
PfeI	GAWTC	1 cut(s)	490
PkrI	GCNGC	3 cut(s)	201, 316, 415
PleI	GAGTC	1 cut(s)	364
PpsI	GAGTC	1 cut(s)	364
PscI	ACATGT	1 cut(s)	364
PspN4I	GGNNCC	1 cut(s)	268
PspPI	GGNCC	1 cut(s)	526
RsaI	GTAC	1 cut(s)	268
RsaNI	GTAC	1 cut(s)	267
SaqAI	TTAA	1 cut(s)	92
SatI	GCNGC	3 cut(s)	200, 315, 414
Sau96I	GGNCC	1 cut(s)	526
SchI	GAGTC	1 cut(s)	365
SetI	ASST	7 cut(s)	46, 166, 204, 275, 319, 336, 376
SfaNI	GCATC	1 cut(s)	334
SfcI	CTRYAG	1 cut(s)	530
Sse9I	AATT	4 cut(s)	66, 100, 186, 417
SspMI	CTAG	1 cut(s)	392
StyI	CCWWGG	1 cut(s)	408
TaqI	TCGA	3 cut(s)	30, 150, 486
TasI	AATT	4 cut(s)	66, 100, 186, 417
TfiI	GAWTC	1 cut(s)	490
Tru1I	TTAA	1 cut(s)	92
Tru9I	TTAA	1 cut(s)	92
TscAI	CASTG	1 cut(s)	228
TseI	GCWGC	3 cut(s)	199, 314, 413
TspDTI	ATGAA	2 cut(s)	429, 472
TspRI	CASTG	1 cut(s)	228
XceI	RCATGY	1 cut(s)	368
XcmI	CCANNNNNNNNNTGG	1 cut(s)	391
XspI	CTAG	1 cut(s)	392

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.