Rmu_sc0024929.1_g000001

Glutaredoxin

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024929.1
Physical Location & Seq
Forward (+)
1 .. 487
487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024929.1_g000001.1.cds

Sequence Viewer

Length: 191 bp
gtgatggtagtgagatacaatcggcgcttgctgagtggactggacagcataccctgcccaatgttttcgttggcggaaaccacattggtgattgtgacacaacctgggatctgcacaaggaaggaaaactggtccctctgctcactgaagctggagttgttgccaaattacaggagttggaaataagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.67

Weight (kDa)

4.48

Isoelectric Point (pI)

40.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 74
AclWI GGATC 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 167
AjnI CCWGG 1 cut(s) 103
AleI CACNNNNGTG 1 cut(s) 86
AluBI AGCT 2 cut(s) 151, 188
AluI AGCT 2 cut(s) 151, 188
AlwI GGATC 1 cut(s) 116
AspLEI GCGC 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 105
BfaI CTAG 1 cut(s) 189
BfoI RGCGCY 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 132
BmgT120I GGNCC 1 cut(s) 132
BmiI GGNNCC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 105
BpmI CTGGAG 1 cut(s) 173
BsaJI CCNNGG 1 cut(s) 104
Bse1I ACTGG 2 cut(s) 45, 134
BseBI CCWGG 1 cut(s) 105
BseDI CCNNGG 1 cut(s) 104
BseMII CTCAG 1 cut(s) 23
BseNI ACTGG 2 cut(s) 45, 134
BsgI GTGCAG 1 cut(s) 97
BslFI GGGAC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 118
Bsp143I GATC 1 cut(s) 108
BspACI CCGC 1 cut(s) 74
BspCNI CTCAG 1 cut(s) 24
BspLI GGNNCC 1 cut(s) 134
BspPI GGATC 1 cut(s) 116
BsrI ACTGG 2 cut(s) 45, 134
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 105
BstAPI GCANNNNNTGC 1 cut(s) 54
BstC8I GCNNGC 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 32
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 1 cut(s) 111
BstMBI GATC 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 54
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 143
Cac8I GCNNGC 1 cut(s) 29
CfoI GCGC 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 132
CviJI RGCY 2 cut(s) 151, 188
CviKI_1 RGCY 2 cut(s) 151, 188
DdeI CTNAG 1 cut(s) 32
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
EciI GGCGGA 1 cut(s) 89
Eco47I GGWCC 1 cut(s) 132
Eco57I CTGAAG 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 103
FaiI YATR 1 cut(s) 50
FaqI GGGAC 1 cut(s) 118
FspBI CTAG 1 cut(s) 189
GlaI GCGC 1 cut(s) 26
GsuI CTGGAG 1 cut(s) 173
HaeII RGCGCY 1 cut(s) 28
HhaI GCGC 1 cut(s) 27
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 114
HpyF10VI GCNNNNNNNGC 1 cut(s) 54
HpyF3I CTNAG 1 cut(s) 32
HspAI GCGC 1 cut(s) 25
Kzo9I GATC 1 cut(s) 108
LpnPI CCDG 7 cut(s) 26, 67, 90, 115, 117, 137, 157
MaeI CTAG 1 cut(s) 189
MaeIII GTNAC 1 cut(s) 94
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MflI RGATCY 1 cut(s) 108
MluCI AATT 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 1 cut(s) 146
MslI CAYNNNNRTG 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 54
NdeII GATC 1 cut(s) 108
NlaIV GGNNCC 1 cut(s) 134
NmuCI GTSAC 1 cut(s) 94
OliI CACNNNNGTG 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 134
PspPI GGNCC 1 cut(s) 132
PsuI RGATCY 1 cut(s) 108
RseI CAYNNNNRTG 1 cut(s) 86
Sau3AI GATC 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 132
ScrFI CCNGG 1 cut(s) 105
SetI ASST 3 cut(s) 106, 153, 190
SgeI CNNG 9 cut(s) 40, 53, 66, 116, 117, 129, 142, 164, 184
SinI GGWCC 1 cut(s) 132
SmiMI CAYNNNNRTG 1 cut(s) 86
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 74
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 103
TasI AATT 1 cut(s) 166
TscAI CASTG 1 cut(s) 150
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspRI CASTG 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 132
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.