Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026230.1

Orthogroup ID

OG0003955

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2312

Gene Structure 2312 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026230.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 654 bp

gtgcaaaagagaagggaaacattattaacagaattaaatggaaaagttcgtgagaacaaaaatgtgttccccaccaaggctgtggactgtgtcttggagaggataaacaatgtaatgggtaaagatagtgttgacagtagagtattttctcaacacatggcttttaccatgttaggagccaccctctttggagatgcatttttagcttggtctaaggcagctgtttacgaggagctccttatgatgattgctaaggatgctggtttttgggcttcttattgtgttactcccttttggaagcctggattttggaaatatcagtctgtatgcacaaagttgaaatgcttaacgcaagatattgttcaacaatgctgcaacctatactcttgggaaactggaaacttaggaaaggaggttgcatctggtggaccatcttgctctgaagttaggatagtagacaatctattctatgaggagcttaatggccattttaatgttagtgaggaaccatatgggaatcttatgggcataatgtttcacggatgcctcagcacagctagtttgattaataacattatgatgaaccttgctacgcatccacaaatacaggataaggtctccctccctccttccctctctctctctcttatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p450

Protein Analysis

217

Amino Acids

24.32

Weight (kDa)

6.11

Isoelectric Point (pI)

32.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003955)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g04131 FvH4_7g04131 FvH4_7g04131 FvH4_7g04131 FvH4_7g04131
malus_domestica	MD02G1275100.v1.1
prunus_persica	Prupe.2G045900_v2.0.a1 Prupe.2G045900_v2.0.a1
pyrus_communis	pycom02g23520
rosa_chinensis	RchiOBHm_Chr1g0328201 RchiOBHm_Chr5g0059421
rosa_laevigata	RLG00000029936
rosa_multiflora	Rmu_sc0002809.1_g000001 Rmu_sc0004646.1_g000039 Rmu_sc0026230.1_g000001
rosa_roxburghii	Rroxscaffold_2G00091240 Rroxscaffold_4G00321720 Rroxscaffold_6G00398480
rosa_rugosa	Rorug01G0074200
rosa_samantha	Rh1AG091600 Rh1BG073600 Rh1BG073900 Rh1CG087800 Rh1CG088000 Rh1DG094900 Rh1DG095000 Rh2BG406200 Rh3AG238100 Rh4DG195500 Rh5BG398600 Rh5DG413900 Rh6AG099200
rosa_wichuraiana	Rw0G011020 Rw1G007070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	456
AcoI	YGGCCR	1 cut(s)	484
AcuI	CTGAAG	1 cut(s)	462
AfiI	CCNNNNNNNGG	1 cut(s)	76
AgsI	TTSAA	2 cut(s)	340, 365
AjnI	CCWGG	1 cut(s)	301
AluBI	AGCT	5 cut(s)	206, 221, 235, 478, 557
AluI	AGCT	5 cut(s)	206, 221, 235, 478, 557
Alw21I	GWGCWC	1 cut(s)	237
Alw26I	GTCTC	1 cut(s)	622
AoxI	GGCC	1 cut(s)	484
ApeKI	GCWGC	2 cut(s)	218, 372
AseI	ATTAAT	1 cut(s)	567
AspS9I	GGNCC	1 cut(s)	428
AvaII	GGWCC	1 cut(s)	428
BalI	TGGCCA	1 cut(s)	486
BanII	GRGCYC	1 cut(s)	237
Bbv12I	GWGCWC	1 cut(s)	237
BbvCI	CCTCAGC	1 cut(s)	548
BbvI	GCAGC	2 cut(s)	230, 359
BccI	CCATC	1 cut(s)	439
BciT130I	CCWGG	1 cut(s)	303
BcoDI	GTCTC	1 cut(s)	622
BfaI	CTAG	1 cut(s)	558
BisI	GCNGC	2 cut(s)	219, 373
BlsI	GCNGC	2 cut(s)	220, 374
Bme1390I	CCNGG	1 cut(s)	303
Bme18I	GGWCC	1 cut(s)	428
BmgT120I	GGNCC	1 cut(s)	428
BmiI	GGNNCC	2 cut(s)	178, 507
BmrFI	CCNGG	1 cut(s)	303
BmsI	GCATC	5 cut(s)	184, 247, 428, 533, 604
BplI	GAGNNNNNCTC	2 cut(s)	168, 200
Bpu10I	CCTNAGC	2 cut(s)	252, 548
BsaI	GGTCTC	1 cut(s)	622
BsaJI	CCNNGG	1 cut(s)	75
Bsc4I	CCNNNNNNNGG	1 cut(s)	76
Bse1I	ACTGG	1 cut(s)	400
BseBI	CCWGG	1 cut(s)	303
BseDI	CCNNGG	1 cut(s)	75
BseGI	GGATG	3 cut(s)	262, 548, 595
BseLI	CCNNNNNNNGG	1 cut(s)	76
BseMII	CTCAG	1 cut(s)	562
BseNI	ACTGG	1 cut(s)	400
BseRI	GAGGAG	2 cut(s)	245, 488
BseXI	GCAGC	2 cut(s)	230, 359
BshFI	GGCC	1 cut(s)	486
BsiHKAI	GWGCWC	1 cut(s)	237
BslI	CCNNNNNNNGG	1 cut(s)	76
BsmAI	GTCTC	1 cut(s)	622
BsnI	GGCC	1 cut(s)	486
Bso31I	GGTCTC	1 cut(s)	622
Bsp1286I	GDGCHC	1 cut(s)	237
BspANI	GGCC	1 cut(s)	486
BspCNI	CTCAG	1 cut(s)	561
BspLI	GGNNCC	2 cut(s)	178, 507
BspTNI	GGTCTC	1 cut(s)	622
BsrI	ACTGG	1 cut(s)	400
BssECI	CCNNGG	1 cut(s)	75
BssT1I	CCWWGG	1 cut(s)	75
Bst2UI	CCWGG	1 cut(s)	303
Bst4CI	ACNGT	2 cut(s)	89, 137
BstDEI	CTNAG	4 cut(s)	213, 252, 403, 548
BstF5I	GGATG	3 cut(s)	262, 548, 595
BstMAI	GTCTC	1 cut(s)	622
BstMWI	GCNNNNNNNGC	2 cut(s)	203, 257
BstNI	CCWGG	1 cut(s)	303
BstSCI	CCNGG	1 cut(s)	301
BstV1I	GCAGC	2 cut(s)	230, 359
BstXI	CCANNNNNNTGG	1 cut(s)	82
BsuRI	GGCC	1 cut(s)	486
BtsCI	GGATG	3 cut(s)	262, 548, 595
Cfr13I	GGNCC	1 cut(s)	428
CspCI	CAANNNNNGTGG	2 cut(s)	169, 204
CviAII	CATG	2 cut(s)	157, 169
DdeI	CTNAG	4 cut(s)	213, 252, 403, 548
EaeI	YGGCCR	1 cut(s)	484
Ecl136II	GAGCTC	1 cut(s)	235
Eco130I	CCWWGG	1 cut(s)	75
Eco24I	GRGCYC	1 cut(s)	237
Eco31I	GGTCTC	1 cut(s)	622
Eco47I	GGWCC	1 cut(s)	428
Eco53kI	GAGCTC	1 cut(s)	235
Eco57I	CTGAAG	1 cut(s)	462
EcoICRI	GAGCTC	1 cut(s)	235
EcoRII	CCWGG	1 cut(s)	301
EcoT14I	CCWWGG	1 cut(s)	75
EcoT22I	ATGCAT	1 cut(s)	199
EcoT38I	GRGCYC	1 cut(s)	237
ErhI	CCWWGG	1 cut(s)	75
FaeI	CATG	2 cut(s)	160, 172
FatI	CATG	2 cut(s)	156, 168
FauNDI	CATATG	1 cut(s)	511
FblI	GTMKAC	1 cut(s)	456
Fnu4HI	GCNGC	2 cut(s)	219, 373
FokI	GGATG	3 cut(s)	269, 555, 582
FriOI	GRGCYC	1 cut(s)	237
Fsp4HI	GCNGC	2 cut(s)	219, 373
FspBI	CTAG	1 cut(s)	558
GluI	GCNGC	2 cut(s)	219, 373
HaeIII	GGCC	1 cut(s)	486
Hin1II	CATG	2 cut(s)	160, 172
HincII	GTYRAC	1 cut(s)	133
HindII	GTYRAC	1 cut(s)	133
HinfI	GANTC	1 cut(s)	517
Hpy166II	GTNNAC	5 cut(s)	85, 133, 226, 428, 457
Hpy188I	TCNGA	1 cut(s)	442
Hpy188III	TCNNGA	1 cut(s)	50
Hpy8I	GTNNAC	5 cut(s)	85, 133, 226, 428, 457
HpyAV	CCTTC	2 cut(s)	6, 639
HpyCH4III	ACNGT	2 cut(s)	89, 137
HpyCH4V	TGCA	5 cut(s)	4, 197, 330, 375, 419
HpyF10VI	GCNNNNNNNGC	2 cut(s)	203, 257
HpyF3I	CTNAG	4 cut(s)	213, 252, 403, 548
Hsp92II	CATG	2 cut(s)	160, 172
LmnI	GCTCC	4 cut(s)	176, 232, 240, 475
LpnPI	CCDG	6 cut(s)	246, 288, 315, 381, 408, 593
Lsp1109I	GCAGC	2 cut(s)	230, 359
LweI	GCATC	5 cut(s)	184, 247, 428, 533, 604
MaeI	CTAG	1 cut(s)	558
MaeIII	GTNAC	1 cut(s)	283
MhlI	GDGCHC	1 cut(s)	237
MlsI	TGGCCA	1 cut(s)	486
MluCI	AATT	1 cut(s)	32
MluNI	TGGCCA	1 cut(s)	486
Mox20I	TGGCCA	1 cut(s)	486
Mph1103I	ATGCAT	1 cut(s)	199
MscI	TGGCCA	1 cut(s)	486
MseI	TTAA	6 cut(s)	26, 35, 347, 480, 492, 567
MslI	CAYNNNNRTG	2 cut(s)	492, 578
Msp20I	TGGCCA	1 cut(s)	486
MspA1I	CMGCKG	1 cut(s)	221
MspR9I	CCNGG	1 cut(s)	303
MvaI	CCWGG	1 cut(s)	303
MwoI	GCNNNNNNNGC	2 cut(s)	203, 257
NdeI	CATATG	1 cut(s)	511
NlaIII	CATG	2 cut(s)	160, 172
NlaIV	GGNNCC	2 cut(s)	178, 507
NsiI	ATGCAT	1 cut(s)	199
PfeI	GAWTC	1 cut(s)	517
PflFI	GACNNNGTC	1 cut(s)	89
PkrI	GCNGC	2 cut(s)	220, 374
PshBI	ATTAAT	1 cut(s)	567
Psp124BI	GAGCTC	1 cut(s)	237
Psp6I	CCWGG	1 cut(s)	301
PspGI	CCWGG	1 cut(s)	301
PspN4I	GGNNCC	2 cut(s)	178, 507
PspPI	GGNCC	1 cut(s)	428
PsyI	GACNNNGTC	1 cut(s)	89
PvuII	CAGCTG	1 cut(s)	221
RseI	CAYNNNNRTG	2 cut(s)	492, 578
SacI	GAGCTC	1 cut(s)	237
SaqAI	TTAA	6 cut(s)	26, 35, 347, 480, 492, 567
SatI	GCNGC	2 cut(s)	219, 373
Sau96I	GGNCC	1 cut(s)	428
ScrFI	CCNGG	1 cut(s)	303
SduI	GDGCHC	1 cut(s)	237
SetI	ASST	9 cut(s)	208, 223, 237, 381, 417, 480, 559, 588, 618
SfaNI	GCATC	5 cut(s)	184, 247, 428, 533, 604
SinI	GGWCC	1 cut(s)	428
SmiMI	CAYNNNNRTG	2 cut(s)	492, 578
Sse9I	AATT	1 cut(s)	32
SspMI	CTAG	1 cut(s)	558
SstI	GAGCTC	1 cut(s)	237
StyD4I	CCNGG	1 cut(s)	301
StyI	CCWWGG	1 cut(s)	75
TaaI	ACNGT	2 cut(s)	89, 137
TasI	AATT	1 cut(s)	32
TfiI	GAWTC	1 cut(s)	517
Tru1I	TTAA	6 cut(s)	26, 35, 347, 480, 492, 567
Tru9I	TTAA	6 cut(s)	26, 35, 347, 480, 492, 567
TseI	GCWGC	2 cut(s)	218, 372
TspDTI	ATGAA	1 cut(s)	596
TspGWI	ACGGA	1 cut(s)	555
Tth111I	GACNNNGTC	1 cut(s)	89
VpaK11BI	GGWCC	1 cut(s)	428
VspI	ATTAAT	1 cut(s)	567
XcmI	CCANNNNNNNNNTGG	1 cut(s)	79
XmiI	GTMKAC	1 cut(s)	456
XspI	CTAG	1 cut(s)	558
Zsp2I	ATGCAT	1 cut(s)	199

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.