Rroxscaffold_2G00091240

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
12843535 .. 12845587
2053 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00091240.1

Sequence Viewer

Length: 282 bp
ATGTCCCTGGAAAGAGCAATACAAACTGAGGTGTTGGCTGATTTGGACAAGAATTATGGCTCTGTTGTGAAGTTGTGGTTGGGACCAACTCAGCTTTTAGTGTCAATAAAGGATCCAACTCTTATCAGAGACATGCTACTAAAGGTTGCAAATAAGTTGCCTTTGACTGGGAGGGCATTCCATTTGGCCTTTGGAAGGTCAAGTCTCTTTGCTTATTATTTTGATGAGAATTTCAAGGGCATTAGTACAGTCATTGCGATTCATTCCCAAATATCAGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.4

Weight (kDa)

9.1

Isoelectric Point (pI)

23.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 107, 120
AcsI RAATTY 1 cut(s) 229
AfaI GTAC 1 cut(s) 247
AfiI CCNNNNNNNGG 2 cut(s) 167, 195
AgsI TTSAA 1 cut(s) 235
AjnI CCWGG 1 cut(s) 6
AjuI GAANNNNNNNTTGG 2 cut(s) 62, 94
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw26I GTCTC 2 cut(s) 123, 209
AlwI GGATC 2 cut(s) 107, 120
AoxI GGCC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 229
AspS9I GGNCC 1 cut(s) 83
AvaII GGWCC 1 cut(s) 83
BamHI GGATCC 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 8
BcoDI GTCTC 2 cut(s) 123, 209
Bme1390I CCNGG 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 83
BmiI GGNNCC 2 cut(s) 84, 114
BmrFI CCNGG 1 cut(s) 8
BmrI ACTGGG 1 cut(s) 177
BmuI ACTGGG 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 6
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 195
Bse1I ACTGG 1 cut(s) 172
Bse3DI GCAATG 1 cut(s) 252
BseBI CCWGG 1 cut(s) 8
BseDI CCNNGG 1 cut(s) 6
BseLI CCNNNNNNNGG 2 cut(s) 167, 195
BseMI GCAATG 1 cut(s) 252
BseMII CTCAG 2 cut(s) 18, 104
BseNI ACTGG 1 cut(s) 172
BshFI GGCC 1 cut(s) 188
BslFI GGGAC 1 cut(s) 96
BslI CCNNNNNNNGG 2 cut(s) 167, 195
BsmAI GTCTC 2 cut(s) 123, 209
BsmFI GGGAC 1 cut(s) 96
BsmI GAATGC 1 cut(s) 176
BsnI GGCC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 1 cut(s) 188
BspCNI CTCAG 2 cut(s) 19, 103
BspLI GGNNCC 2 cut(s) 84, 114
BspPI GGATC 2 cut(s) 107, 120
BsrDI GCAATG 1 cut(s) 252
BsrI ACTGG 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 250
BstDEI CTNAG 2 cut(s) 27, 90
BstENI CCTNNNNNAGG 1 cut(s) 193
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 2 cut(s) 123, 209
BstMBI GATC 1 cut(s) 112
BstNI CCWGG 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 136
BstSCI CCNGG 1 cut(s) 6
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BsuRI GGCC 1 cut(s) 188
BtsIMutI CAGTG 1 cut(s) 282
Cfr13I GGNCC 1 cut(s) 83
Csp6I GTAC 1 cut(s) 246
CviAII CATG 1 cut(s) 133
CviJI RGCY 4 cut(s) 38, 60, 94, 188
CviKI_1 RGCY 4 cut(s) 38, 60, 94, 188
CviQI GTAC 1 cut(s) 246
DdeI CTNAG 2 cut(s) 27, 90
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 83
EcoNI CCTNNNNNAGG 1 cut(s) 193
EcoRII CCWGG 1 cut(s) 6
FaeI CATG 1 cut(s) 136
FaiI YATR 2 cut(s) 57, 134
FaqI GGGAC 1 cut(s) 96
FatI CATG 1 cut(s) 132
HaeIII GGCC 1 cut(s) 188
Hin1II CATG 1 cut(s) 136
HinfI GANTC 1 cut(s) 259
Hpy188I TCNGA 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 189
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4V TGCA 1 cut(s) 149
HpyF3I CTNAG 2 cut(s) 27, 90
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 20, 153
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MflI RGATCY 1 cut(s) 112
MluCI AATT 2 cut(s) 52, 229
MmeI TCCRAC 1 cut(s) 140
MnlI CCTC 2 cut(s) 22, 165
MspR9I CCNGG 1 cut(s) 8
Mva1269I GAATGC 1 cut(s) 176
MvaI CCWGG 1 cut(s) 8
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 136
NlaIV GGNNCC 2 cut(s) 84, 114
NspI RCATGY 1 cut(s) 136
PctI GAATGC 1 cut(s) 176
PfeI GAWTC 1 cut(s) 259
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 2 cut(s) 84, 114
PspPI GGNCC 1 cut(s) 83
PsuI RGATCY 1 cut(s) 112
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 1 cut(s) 83
ScrFI CCNGG 1 cut(s) 8
SetI ASST 4 cut(s) 33, 96, 147, 200
SgeI CNNG 7 cut(s) 19, 20, 61, 145, 180, 213, 247
SinI GGWCC 1 cut(s) 83
Sse9I AATT 2 cut(s) 52, 229
StyD4I CCNGG 1 cut(s) 6
TaaI ACNGT 1 cut(s) 250
TasI AATT 2 cut(s) 52, 229
TatI WGTACW 1 cut(s) 245
TfiI GAWTC 1 cut(s) 259
TscAI CASTG 1 cut(s) 282
TspDTI ATGAA 1 cut(s) 251
TspRI CASTG 1 cut(s) 282
VpaK11BI GGWCC 1 cut(s) 83
XagI CCTNNNNNAGG 1 cut(s) 193
XapI RAATTY 1 cut(s) 229
XceI RCATGY 1 cut(s) 136
XcmI CCANNNNNNNNNTGG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.