Rmu_sc0035636.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035636.1
Physical Location & Seq
Forward (+)
64 .. 1941
1878 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035636.1_g000001.1.cds

Sequence Viewer

Length: 747 bp
atgagaagtcaattttctcatttttcagaagcaacaacatcaacactaagcccaagatttgatgatgatcaggagtcaacggatggcgaaattttggagacatcaactttgagagtcttcagttttgcagatatgaaatctgctaccaagaacttcaagtcagatcaaattctgggtgagggaggatttggtagagttttcaaaggttgggtggatgagaaaactcttcaaccatgtaaggctggcactggaatgatggttgctgtcaagaaattaaaccctgaaagtatgcaaggtttccaagagtggcagtcagaagtgaactttctaggaaggctttctcatcccaaccttgtcaagctattgggatactgttgggaagacacggaactactccttgtttatgagttcatgcagaaaggtagcttggagaatcaccttttcagaaggaatcctaacattgaaccactatcttgggacattagaatcagaatagctattggagcagctcgaggcctagcattcttgcacagttcagaaaagcaaatcatatatagagatttcaaggcctcaaatatattgcttgatgggaattataatgcaaaaatctcagattttggcttggcgaaattgggaccaactggtggagactcacatgtgtcaactagagttatggggacatatggttatgctgctccagaatacattgcaacaggtaatgatatctatagtaaaaatggaagctaa

Protein Analysis

248

Amino Acids

27.72

Weight (kDa)

5.99

Isoelectric Point (pI)

28.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 597
AccB7I CCANNNNNTGG 1 cut(s) 644
AcsI RAATTY 2 cut(s) 90, 168
AcuI CTGAAG 1 cut(s) 103
AfiI CCNNNNNNNGG 1 cut(s) 644
AflIII ACRYGT 1 cut(s) 655
AgsI TTSAA 5 cut(s) 157, 202, 230, 464, 565
AjuI GAANNNNNNNTTGG 2 cut(s) 410, 442
AluBI AGCT 5 cut(s) 361, 426, 497, 509, 744
AluI AGCT 5 cut(s) 361, 426, 497, 509, 744
Alw26I GTCTC 2 cut(s) 92, 642
Ama87I CYCGRG 1 cut(s) 510
AoxI GGCC 2 cut(s) 514, 567
ApeKI GCWGC 2 cut(s) 506, 692
ApoI RAATTY 2 cut(s) 90, 168
ArsI GACNNNNNNTTYG 2 cut(s) 91, 123
Asp700I GAANNNNTTC 1 cut(s) 337
AspS9I GGNCC 1 cut(s) 635
AsuHPI GGTGA 2 cut(s) 188, 428
AvaI CYCGRG 1 cut(s) 510
AvaII GGWCC 1 cut(s) 635
BbsI GAAGAC 2 cut(s) 109, 387
BbvI GCAGC 2 cut(s) 518, 679
BccI CCATC 3 cut(s) 77, 250, 581
BciVI GTATCC 1 cut(s) 362
BclI TGATCA 1 cut(s) 67
BcoDI GTCTC 2 cut(s) 92, 642
BfaI CTAG 3 cut(s) 329, 518, 666
BfmI CTRYAG 1 cut(s) 727
BfuI GTATCC 1 cut(s) 362
BisI GCNGC 2 cut(s) 507, 693
BlsI GCNGC 2 cut(s) 508, 694
Bme18I GGWCC 1 cut(s) 635
BmeT110I CYCGRG 1 cut(s) 510
BmgT120I GGNCC 1 cut(s) 635
BmiI GGNNCC 1 cut(s) 636
BpiI GAAGAC 2 cut(s) 109, 387
BpmI CTGGAG 1 cut(s) 681
BsaBI GATNNNNATC 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 644
Bse1I ACTGG 2 cut(s) 253, 646
Bse3DI GCAATG 1 cut(s) 705
Bse8I GATNNNNATC 1 cut(s) 66
BseGI GGATG 3 cut(s) 88, 220, 343
BseJI GATNNNNATC 1 cut(s) 66
BseLI CCNNNNNNNGG 1 cut(s) 644
BseMI GCAATG 1 cut(s) 705
BseMII CTCAG 1 cut(s) 624
BseNI ACTGG 2 cut(s) 253, 646
BseXI GCAGC 2 cut(s) 518, 679
BshFI GGCC 2 cut(s) 516, 569
BsiHKCI CYCGRG 1 cut(s) 510
BslFI GGGAC 3 cut(s) 491, 648, 691
BslI CCNNNNNNNGG 1 cut(s) 644
BsmAI GTCTC 2 cut(s) 92, 642
BsmFI GGGAC 3 cut(s) 491, 648, 691
BsmI GAATGC 1 cut(s) 521
BsnI GGCC 2 cut(s) 516, 569
BsoBI CYCGRG 1 cut(s) 510
Bsp143I GATC 2 cut(s) 67, 163
BspANI GGCC 2 cut(s) 516, 569
BspCNI CTCAG 1 cut(s) 623
BspLI GGNNCC 1 cut(s) 636
BsrDI GCAATG 1 cut(s) 705
BsrI ACTGG 2 cut(s) 253, 646
BssMI GATC 2 cut(s) 67, 163
Bst4CI ACNGT 2 cut(s) 374, 533
Bst6I CTCTTC 1 cut(s) 231
BstC8I GCNNGC 1 cut(s) 244
BstDEI CTNAG 2 cut(s) 47, 610
BstF5I GGATG 3 cut(s) 88, 220, 343
BstKTI GATC 2 cut(s) 70, 166
BstMAI GTCTC 2 cut(s) 92, 642
BstMBI GATC 2 cut(s) 67, 163
BstMWI GCNNNNNNNGC 1 cut(s) 503
BstNSI RCATGY 1 cut(s) 659
BstSFI CTRYAG 1 cut(s) 727
BstV1I GCAGC 2 cut(s) 518, 679
BstV2I GAAGAC 2 cut(s) 109, 387
BstXI CCANNNNNNTGG 1 cut(s) 474
BsuI GTATCC 1 cut(s) 362
BsuRI GGCC 2 cut(s) 516, 569
BtsCI GGATG 3 cut(s) 88, 220, 343
BtsIMutI CAGTG 1 cut(s) 246
Cac8I GCNNGC 1 cut(s) 244
Cfr13I GGNCC 1 cut(s) 635
CviAII CATG 3 cut(s) 234, 412, 656
DdeI CTNAG 2 cut(s) 47, 610
DpnI GATC 2 cut(s) 69, 165
DpnII GATC 2 cut(s) 67, 163
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
Eco147I AGGCCT 2 cut(s) 516, 569
Eco32I GATATC 1 cut(s) 724
Eco47I GGWCC 1 cut(s) 635
Eco57I CTGAAG 1 cut(s) 103
Eco88I CYCGRG 1 cut(s) 510
EcoRV GATATC 1 cut(s) 724
FaeI CATG 3 cut(s) 237, 415, 659
FaqI GGGAC 3 cut(s) 491, 648, 691
FatI CATG 3 cut(s) 233, 411, 655
FauNDI CATATG 1 cut(s) 682
FbaI TGATCA 1 cut(s) 67
Fnu4HI GCNGC 2 cut(s) 507, 693
FokI GGATG 3 cut(s) 95, 227, 330
Fsp4HI GCNGC 2 cut(s) 507, 693
FspBI CTAG 3 cut(s) 329, 518, 666
GluI GCNGC 2 cut(s) 507, 693
GsuI CTGGAG 1 cut(s) 681
HaeIII GGCC 2 cut(s) 516, 569
Hin1II CATG 3 cut(s) 237, 415, 659
HincII GTYRAC 2 cut(s) 78, 663
HindII GTYRAC 2 cut(s) 78, 663
HinfI GANTC 6 cut(s) 74, 114, 433, 451, 486, 650
HphI GGTGA 2 cut(s) 188, 428
Hpy166II GTNNAC 3 cut(s) 78, 322, 663
Hpy188I TCNGA 7 cut(s) 28, 163, 316, 446, 491, 538, 613
Hpy188III TCNNGA 3 cut(s) 71, 268, 698
Hpy8I GTNNAC 3 cut(s) 78, 322, 663
HpyAV CCTTC 2 cut(s) 327, 441
HpyCH4III ACNGT 2 cut(s) 374, 533
HpyCH4V TGCA 6 cut(s) 128, 292, 415, 529, 602, 710
HpyF10VI GCNNNNNNNGC 1 cut(s) 503
HpyF3I CTNAG 2 cut(s) 47, 610
Hsp92II CATG 3 cut(s) 237, 415, 659
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 2 cut(s) 67, 163
LmnI GCTCC 2 cut(s) 503, 700
LpnPI CCDG 8 cut(s) 56, 158, 228, 234, 294, 627, 699, 711
Lsp1109I GCAGC 2 cut(s) 518, 679
MaeI CTAG 3 cut(s) 329, 518, 666
MalI GATC 2 cut(s) 69, 165
MboI GATC 2 cut(s) 67, 163
MboII GAAGA 3 cut(s) 109, 218, 392
MluCI AATT 6 cut(s) 11, 90, 168, 272, 592, 629
MlyI GAGTC 3 cut(s) 83, 123, 644
MnlI CCTC 4 cut(s) 172, 176, 506, 580
MroXI GAANNNNTTC 1 cut(s) 337
MseI TTAA 1 cut(s) 275
MslI CAYNNNNRTG 1 cut(s) 251
Mva1269I GAATGC 1 cut(s) 521
MwoI GCNNNNNNNGC 1 cut(s) 503
NdeI CATATG 1 cut(s) 682
NdeII GATC 2 cut(s) 67, 163
NlaIII CATG 3 cut(s) 237, 415, 659
NlaIV GGNNCC 1 cut(s) 636
NspI RCATGY 1 cut(s) 659
PaeR7I CTCGAG 1 cut(s) 510
PceI AGGCCT 2 cut(s) 516, 569
PciI ACATGT 1 cut(s) 655
PctI GAATGC 1 cut(s) 521
PdmI GAANNNNTTC 1 cut(s) 337
PfeI GAWTC 3 cut(s) 433, 451, 486
PflMI CCANNNNNTGG 1 cut(s) 644
PkrI GCNGC 2 cut(s) 508, 694
PleI GAGTC 3 cut(s) 82, 122, 644
PpsI GAGTC 3 cut(s) 82, 122, 644
PscI ACATGT 1 cut(s) 655
PsiI TTATAA 1 cut(s) 597
PspN4I GGNNCC 1 cut(s) 636
PspPI GGNCC 1 cut(s) 635
PspXI VCTCGAGB 1 cut(s) 510
RseI CAYNNNNRTG 1 cut(s) 251
SaqAI TTAA 1 cut(s) 275
SatI GCNGC 2 cut(s) 507, 693
Sau3AI GATC 2 cut(s) 67, 163
Sau96I GGNCC 1 cut(s) 635
SchI GAGTC 3 cut(s) 83, 123, 644
SfcI CTRYAG 1 cut(s) 727
Sfr274I CTCGAG 1 cut(s) 510
SinI GGWCC 1 cut(s) 635
SlaI CTCGAG 1 cut(s) 510
SmiMI CAYNNNNRTG 1 cut(s) 251
SmlI CTYRAG 1 cut(s) 510
SmoI CTYRAG 1 cut(s) 510
Sse9I AATT 6 cut(s) 11, 90, 168, 272, 592, 629
SseBI AGGCCT 2 cut(s) 516, 569
SspMI CTAG 3 cut(s) 329, 518, 666
StuI AGGCCT 2 cut(s) 516, 569
TaaI ACNGT 2 cut(s) 374, 533
TaqI TCGA 1 cut(s) 511
TasI AATT 6 cut(s) 11, 90, 168, 272, 592, 629
TfiI GAWTC 3 cut(s) 433, 451, 486
Tru1I TTAA 1 cut(s) 275
Tru9I TTAA 1 cut(s) 275
TscAI CASTG 1 cut(s) 253
TseI GCWGC 2 cut(s) 506, 692
TspDTI ATGAA 2 cut(s) 149, 400
TspGWI ACGGA 2 cut(s) 95, 401
TspRI CASTG 1 cut(s) 253
Van91I CCANNNNNTGG 1 cut(s) 644
VpaK11BI GGWCC 1 cut(s) 635
XapI RAATTY 2 cut(s) 90, 168
XceI RCATGY 1 cut(s) 659
XhoI CTCGAG 1 cut(s) 510
XmnI GAANNNNTTC 1 cut(s) 337
XspI CTAG 3 cut(s) 329, 518, 666
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.