Rmu_sc0042869.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042869.1
Physical Location & Seq
Reverse (-)
1885 .. 2226
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042869.1_g000001.1.cds

Sequence Viewer

Length: 342 bp
atggagatggtggagaagggtatatcacccgatgcagttacctattcatctctaattcaagaagggagattagttgacgcttgtgatctcttccaagaaatgataagtatggggttgcgtcctgatgaattcacatacacaaccttgatcaatgcttactgcaaggaaggggatttgaataaggctcttcacttgaatgatgaaatgataaagaaaggtttcctacctgatgttgtgacctacagtgtgcttatcaatggacttaacaaacaatctcggacaagagaagcaaagaagcttctactcaagttgttctatgataactctagctgtcccagatga

Protein Analysis

113

Amino Acids

12.84

Weight (kDa)

5.38

Isoelectric Point (pI)

39.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 128
AgsI TTSAA 3 cut(s) 59, 178, 196
AluBI AGCT 2 cut(s) 298, 330
AluI AGCT 2 cut(s) 298, 330
ApoI RAATTY 1 cut(s) 128
Asp700I GAANNNNTTC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 18
BclI TGATCA 1 cut(s) 147
BfaI CTAG 1 cut(s) 327
BfmI CTRYAG 1 cut(s) 241
BmsI GCATC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 290
BslFI GGGAC 1 cut(s) 318
BsmFI GGGAC 1 cut(s) 318
Bsp143I GATC 2 cut(s) 85, 147
BspQI GCTCTTC 1 cut(s) 192
BssMI GATC 2 cut(s) 85, 147
Bst4CI ACNGT 1 cut(s) 245
Bst6I CTCTTC 2 cut(s) 95, 192
BstKTI GATC 2 cut(s) 88, 150
BstMBI GATC 2 cut(s) 85, 147
BstSFI CTRYAG 1 cut(s) 241
BtsIMutI CAGTG 1 cut(s) 250
CseI GACGC 2 cut(s) 86, 107
CviJI RGCY 3 cut(s) 185, 298, 330
CviKI_1 RGCY 3 cut(s) 185, 298, 330
DpnI GATC 2 cut(s) 87, 149
DpnII GATC 2 cut(s) 85, 147
Eam1104I CTCTTC 2 cut(s) 95, 192
EarI CTCTTC 2 cut(s) 95, 192
EcoRI GAATTC 1 cut(s) 128
FaiI YATR 4 cut(s) 23, 110, 136, 318
FaqI GGGAC 1 cut(s) 318
FbaI TGATCA 1 cut(s) 147
FspBI CTAG 1 cut(s) 327
HgaI GACGC 2 cut(s) 86, 107
HincII GTYRAC 1 cut(s) 76
HindII GTYRAC 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 296
HphI GGTGA 1 cut(s) 18
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 279
Hpy188III TCNNGA 2 cut(s) 59, 122
Hpy8I GTNNAC 1 cut(s) 76
HpyAV CCTTC 3 cut(s) 10, 56, 161
HpyCH4III ACNGT 1 cut(s) 245
HpyCH4V TGCA 2 cut(s) 35, 162
Ksp22I TGATCA 1 cut(s) 147
Kzo9I GATC 2 cut(s) 85, 147
LguI GCTCTTC 1 cut(s) 192
LpnPI CCDG 2 cut(s) 135, 240
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 327
MaeIII GTNAC 2 cut(s) 37, 235
MalI GATC 2 cut(s) 87, 149
MboI GATC 2 cut(s) 85, 147
MboII GAAGA 2 cut(s) 82, 179
MluCI AATT 2 cut(s) 54, 128
MroXI GAANNNNTTC 1 cut(s) 218
MseI TTAA 1 cut(s) 264
MslI CAYNNNNRTG 1 cut(s) 195
NdeII GATC 2 cut(s) 85, 147
NmuCI GTSAC 1 cut(s) 235
PciSI GCTCTTC 1 cut(s) 192
PdmI GAANNNNTTC 1 cut(s) 218
RseI CAYNNNNRTG 1 cut(s) 195
SapI GCTCTTC 1 cut(s) 192
SaqAI TTAA 1 cut(s) 264
Sau3AI GATC 2 cut(s) 85, 147
SetI ASST 7 cut(s) 44, 146, 220, 229, 242, 300, 332
SfaNI GCATC 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 241
SmiMI CAYNNNNRTG 1 cut(s) 195
SmlI CTYRAG 1 cut(s) 305
SmoI CTYRAG 1 cut(s) 305
Sse9I AATT 2 cut(s) 54, 128
SspMI CTAG 1 cut(s) 327
TaaI ACNGT 1 cut(s) 245
TasI AATT 2 cut(s) 54, 128
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TscAI CASTG 1 cut(s) 250
TseFI GTSAC 1 cut(s) 235
Tsp45I GTSAC 1 cut(s) 235
TspDTI ATGAA 3 cut(s) 36, 141, 216
TspRI CASTG 1 cut(s) 250
XapI RAATTY 1 cut(s) 128
XmnI GAANNNNTTC 1 cut(s) 218
XspI CTAG 1 cut(s) 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.