Rmu_ssc0000014.1_g000009

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000014.1
Physical Location & Seq
Reverse (-)
45949 .. 47878
1930 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000014.1_g000009.1.cds

Sequence Viewer

Length: 1320 bp
atggcaaagcaaattcgtaacccttctgctgaactcgaagacctgttaagagatcacacctcatatcaaaatccggaatttttggctctatcagggcaacataagtaccattttacttccaatcctttgtatcctgatggcagtgttgaaaaccttcggtacattaaatacgaaccaatcacagggatagagtgctttgccacgggacagatatttgacaattgtggtgatgctattgaacattggaagattcaaaaaagatatgacgcaagatttgtcatgcacccacaggaatgtgtaacggtgaaacatgattcgaaagttctttacatgttgattttccccaaggttatcagagacattagcgtatggattgaagaacatgccaaaggacaagtttcagatgtggatatgtgggaggtcctgaagaagactgagaaagcaatgagatatttatcggtggaatcacactcacgtcgatcacatggaaatctcttgagaggcattggtatagcagcggatcttaatgtatacttcttcaacttcggcgctgataaaaaaggatacaatactgatatccaagtgcttgatgatattctcacatccattgagcctaagttggtggatcctacaattcaacattgtgtcactcggtggaagtcctttctctctatggcttgttcactgtctccttgtgctattacgccacctctttttcgtccctttgactctaaccatgtcagagttattcttcattatccggcatcttgggacgatgaagagaaacttcggttcttggcaaacattcataaattatgcacggacaagtgcaaccggcataattccaatttgatgaatgatatcacatttgatgctgagatggtgaaaaaatattctaactgggggaatctcataagtgccacaactaatgccttatctcaagtctaccaatttggttgccgccaaggaaattatttgagaactgatctagcgggaaacagggtcttatgggaggcatcagttgttgtgtttgctcacaatagtgttaagcactattctgagagggcgcaatggcataacaacaggctattaaacaatccttcttttacatatatgccggagcttatatcaagtcaagcatcacatgttcaatctttctcagatattgagcgaaagattataagctgcagacatcttggtcgattaatggcttattcacagccgcctcagcaatctgatgggtactttcttatttcgaatctactgaagcctttccacattgactttcctaacacctttctagtagctgtctactgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

439

Amino Acids

50.7

Weight (kDa)

7.3

Isoelectric Point (pI)

49.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1181
AasI GACNNNNNNGTC 1 cut(s) 1197
AccI GTMKAC 3 cut(s) 531, 945, 1311
AccIII TCCGGA 1 cut(s) 73
AciI CCGC 4 cut(s) 518, 961, 992, 1223
AclWI GGATC 3 cut(s) 528, 620, 633
AcsI RAATTY 2 cut(s) 12, 77
AcuI CTGAAG 2 cut(s) 446, 1286
AdeI CACNNNGTG 1 cut(s) 654
AfaI GTAC 3 cut(s) 107, 161, 1244
AfiI CCNNNNNNNGG 1 cut(s) 182
AflIII ACRYGT 2 cut(s) 330, 1144
AgsI TTSAA 7 cut(s) 149, 239, 254, 377, 541, 638, 1151
AjiI CACGTC 1 cut(s) 476
AleI CACNNNNGTG 1 cut(s) 1041
AluBI AGCT 3 cut(s) 1123, 1185, 1307
AluI AGCT 3 cut(s) 1123, 1185, 1307
Alw26I GTCTC 2 cut(s) 351, 693
AlwI GGATC 3 cut(s) 528, 620, 633
Aor13HI TCCGGA 1 cut(s) 73
ApeKI GCWGC 2 cut(s) 515, 1185
ApoI RAATTY 2 cut(s) 12, 77
ArsI GACNNNNNNTTYG 2 cut(s) 257, 289
AseI ATTAAT 1 cut(s) 1205
Asp700I GAANNNNTTC 2 cut(s) 153, 1271
AspLEI GCGC 2 cut(s) 551, 1069
AspS9I GGNCC 1 cut(s) 421
AsuHPI GGTGA 3 cut(s) 239, 316, 895
AsuII TTCGAA 2 cut(s) 317, 1256
AvaII GGWCC 1 cut(s) 421
BaeI ACNNNNGTAYC 2 cut(s) 89, 122
BamHI GGATCC 1 cut(s) 625
BbsI GAAGAC 2 cut(s) 45, 437
BbvCI CCTCAGC 1 cut(s) 1227
BbvI GCAGC 2 cut(s) 527, 1172
BccI CCATC 3 cut(s) 131, 874, 1232
BciVI GTATCC 2 cut(s) 141, 557
BcoDI GTCTC 2 cut(s) 351, 693
BfaI CTAG 3 cut(s) 989, 1301, 1318
BfmI CTRYAG 1 cut(s) 1186
BfoI RGCGCY 1 cut(s) 552
BfuI GTATCC 2 cut(s) 141, 557
BisI GCNGC 4 cut(s) 516, 961, 1186, 1223
BlsI GCNGC 4 cut(s) 517, 962, 1187, 1224
Bme18I GGWCC 1 cut(s) 421
BmgBI CACGTC 1 cut(s) 476
BmgT120I GGNCC 1 cut(s) 421
BmiI GGNNCC 1 cut(s) 627
BmrI ACTGGG 1 cut(s) 910
BmsI GCATC 5 cut(s) 220, 773, 862, 1025, 1148
BmuI ACTGGG 1 cut(s) 910
BpiI GAAGAC 2 cut(s) 45, 437
Bpu10I CCTNAGC 1 cut(s) 1227
Bpu14I TTCGAA 2 cut(s) 317, 1256
BpuEI CTTGAG 2 cut(s) 517, 924
BsaBI GATNNNNATC 1 cut(s) 454
BsaJI CCNNGG 3 cut(s) 201, 345, 964
BsaWI WCCGGW 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 182
Bse118I RCCGGY 1 cut(s) 834
Bse1I ACTGG 1 cut(s) 905
Bse3DI GCAATG 2 cut(s) 450, 1076
Bse8I GATNNNNATC 1 cut(s) 454
BseAI TCCGGA 1 cut(s) 73
BseDI CCNNGG 3 cut(s) 201, 345, 964
BseGI GGATG 1 cut(s) 602
BseJI GATNNNNATC 1 cut(s) 454
BseLI CCNNNNNNNGG 1 cut(s) 182
BseMI GCAATG 2 cut(s) 450, 1076
BseMII CTCAG 5 cut(s) 426, 867, 1050, 1173, 1241
BseNI ACTGG 1 cut(s) 905
BseXI GCAGC 2 cut(s) 527, 1172
BsiSI CCGG 4 cut(s) 74, 761, 835, 1118
BslFI GGGAC 3 cut(s) 219, 705, 785
BslI CCNNNNNNNGG 1 cut(s) 182
BsmAI GTCTC 2 cut(s) 351, 693
BsmFI GGGAC 3 cut(s) 219, 705, 785
Bsp119I TTCGAA 2 cut(s) 317, 1256
Bsp13I TCCGGA 1 cut(s) 73
Bsp143I GATC 5 cut(s) 52, 479, 520, 625, 985
BspACI CCGC 4 cut(s) 518, 961, 992, 1223
BspCNI CTCAG 5 cut(s) 427, 868, 1051, 1172, 1240
BspEI TCCGGA 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 627
BspMAI CTGCAG 1 cut(s) 1190
BspPI GGATC 3 cut(s) 528, 620, 633
BspT104I TTCGAA 2 cut(s) 317, 1256
BsrDI GCAATG 2 cut(s) 450, 1076
BsrFI RCCGGY 1 cut(s) 834
BsrI ACTGG 1 cut(s) 905
BssAI RCCGGY 1 cut(s) 834
BssECI CCNNGG 3 cut(s) 201, 345, 964
BssMI GATC 5 cut(s) 52, 479, 520, 625, 985
BssNAI GTATAC 1 cut(s) 532
BssT1I CCWWGG 2 cut(s) 345, 964
Bst1107I GTATAC 1 cut(s) 532
Bst4CI ACNGT 2 cut(s) 304, 687
Bst6I CTCTTC 1 cut(s) 774
BstBI TTCGAA 2 cut(s) 317, 1256
BstDEI CTNAG 6 cut(s) 435, 615, 876, 1059, 1159, 1227
BstDSI CCRYGG 1 cut(s) 201
BstF5I GGATG 1 cut(s) 602
BstH2I RGCGCY 1 cut(s) 552
BstHHI GCGC 2 cut(s) 551, 1069
BstKTI GATC 5 cut(s) 55, 482, 523, 628, 988
BstMAI GTCTC 2 cut(s) 351, 693
BstMBI GATC 5 cut(s) 52, 479, 520, 625, 985
BstMWI GCNNNNNNNGC 1 cut(s) 1228
BstNSI RCATGY 3 cut(s) 334, 386, 1148
BstSFI CTRYAG 1 cut(s) 1186
BstV1I GCAGC 2 cut(s) 527, 1172
BstV2I GAAGAC 2 cut(s) 45, 437
BstX2I RGATCY 2 cut(s) 520, 625
BstYI RGATCY 2 cut(s) 520, 625
BstZ17I GTATAC 1 cut(s) 532
BsuI GTATCC 2 cut(s) 141, 557
BtgI CCRYGG 1 cut(s) 201
BtrI CACGTC 1 cut(s) 476
BtsCI GGATG 1 cut(s) 602
BtsI GCAGTG 1 cut(s) 148
BtsIMutI CAGTG 2 cut(s) 148, 683
CfoI GCGC 2 cut(s) 551, 1069
Cfr10I RCCGGY 1 cut(s) 834
Cfr13I GGNCC 1 cut(s) 421
CseI GACGC 1 cut(s) 275
Csp6I GTAC 3 cut(s) 106, 160, 1243
CviAII CATG 7 cut(s) 280, 311, 331, 383, 485, 737, 1145
CviQI GTAC 3 cut(s) 106, 160, 1243
DdeI CTNAG 6 cut(s) 435, 615, 876, 1059, 1159, 1227
DpnI GATC 5 cut(s) 54, 481, 522, 627, 987
DpnII GATC 5 cut(s) 52, 479, 520, 625, 985
DraIII CACNNNGTG 1 cut(s) 654
DrdI GACNNNNNNGTC 1 cut(s) 1197
DseDI GACNNNNNNGTC 1 cut(s) 1197
Eam1104I CTCTTC 1 cut(s) 774
EarI CTCTTC 1 cut(s) 774
Eco130I CCWWGG 2 cut(s) 345, 964
Eco32I GATATC 2 cut(s) 577, 862
Eco47I GGWCC 1 cut(s) 421
Eco57I CTGAAG 2 cut(s) 446, 1286
EcoO109I RGGNCCY 1 cut(s) 421
EcoRV GATATC 2 cut(s) 577, 862
EcoT14I CCWWGG 2 cut(s) 345, 964
ErhI CCWWGG 2 cut(s) 345, 964
FaeI CATG 7 cut(s) 283, 314, 334, 386, 488, 740, 1148
FalI AAGNNNNNCTT 2 cut(s) 771, 803
FaqI GGGAC 3 cut(s) 219, 705, 785
FatI CATG 7 cut(s) 279, 310, 330, 382, 484, 736, 1144
FauI CCCGC 1 cut(s) 985
FblI GTMKAC 3 cut(s) 531, 945, 1311
Fnu4HI GCNGC 4 cut(s) 516, 961, 1186, 1223
FokI GGATG 1 cut(s) 589
Fsp4HI GCNGC 4 cut(s) 516, 961, 1186, 1223
FspBI CTAG 3 cut(s) 989, 1301, 1318
GlaI GCGC 2 cut(s) 550, 1068
GluI GCNGC 4 cut(s) 516, 961, 1186, 1223
HaeII RGCGCY 1 cut(s) 552
HapII CCGG 4 cut(s) 74, 761, 835, 1118
HgaI GACGC 1 cut(s) 275
HhaI GCGC 2 cut(s) 551, 1069
Hin1II CATG 7 cut(s) 283, 314, 334, 386, 488, 740, 1148
Hin6I GCGC 2 cut(s) 549, 1067
HinP1I GCGC 2 cut(s) 549, 1067
HinfI GANTC 6 cut(s) 250, 314, 464, 728, 907, 1258
HpaII CCGG 4 cut(s) 74, 761, 835, 1118
HphI GGTGA 3 cut(s) 239, 316, 895
Hpy166II GTNNAC 4 cut(s) 532, 683, 946, 1312
Hpy188I TCNGA 6 cut(s) 356, 403, 743, 1060, 1162, 1237
Hpy188III TCNNGA 4 cut(s) 74, 134, 424, 496
Hpy8I GTNNAC 4 cut(s) 532, 683, 946, 1312
Hpy99I CGWCG 1 cut(s) 480
HpyAV CCTTC 3 cut(s) 33, 164, 1110
HpyCH4III ACNGT 2 cut(s) 304, 687
HpyCH4IV ACGT 1 cut(s) 475
HpyCH4V TGCA 4 cut(s) 283, 819, 831, 1188
HpyF10VI GCNNNNNNNGC 1 cut(s) 1228
HpyF3I CTNAG 6 cut(s) 435, 615, 876, 1059, 1159, 1227
HpySE526I ACGT 1 cut(s) 475
Hsp92II CATG 7 cut(s) 283, 314, 334, 386, 488, 740, 1148
HspAI GCGC 2 cut(s) 549, 1067
Kpn2I TCCGGA 1 cut(s) 73
Kzo9I GATC 5 cut(s) 52, 479, 520, 625, 985
LmnI GCTCC 1 cut(s) 1120
Lsp1109I GCAGC 2 cut(s) 527, 1172
LweI GCATC 5 cut(s) 220, 773, 862, 1025, 1148
MaeI CTAG 3 cut(s) 989, 1301, 1318
MaeII ACGT 1 cut(s) 475
MaeIII GTNAC 3 cut(s) 17, 298, 646
MalI GATC 5 cut(s) 54, 481, 522, 627, 987
MboI GATC 5 cut(s) 52, 479, 520, 625, 985
MboII GAAGA 8 cut(s) 50, 259, 389, 439, 442, 529, 743, 791
MfeI CAATTG 1 cut(s) 220
MflI RGATCY 2 cut(s) 520, 625
MluCI AATT 9 cut(s) 12, 77, 220, 633, 812, 841, 847, 950, 970
MlyI GAGTC 1 cut(s) 722
MnlI CCTC 7 cut(s) 70, 412, 494, 720, 1006, 1056, 1236
MroI TCCGGA 1 cut(s) 73
MroXI GAANNNNTTC 2 cut(s) 153, 1271
MseI TTAA 6 cut(s) 47, 165, 525, 1047, 1091, 1205
MslI CAYNNNNRTG 2 cut(s) 292, 1041
MspA1I CMGCKG 1 cut(s) 518
MspI CCGG 4 cut(s) 74, 761, 835, 1118
MunI CAATTG 1 cut(s) 220
MwoI GCNNNNNNNGC 1 cut(s) 1228
NdeII GATC 5 cut(s) 52, 479, 520, 625, 985
NlaIII CATG 7 cut(s) 283, 314, 334, 386, 488, 740, 1148
NlaIV GGNNCC 1 cut(s) 627
NmuCI GTSAC 1 cut(s) 646
NspI RCATGY 3 cut(s) 334, 386, 1148
NspV TTCGAA 2 cut(s) 317, 1256
OliI CACNNNNGTG 1 cut(s) 1041
PciI ACATGT 2 cut(s) 330, 1144
PdmI GAANNNNTTC 2 cut(s) 153, 1271
PfeI GAWTC 5 cut(s) 250, 314, 464, 907, 1258
PkrI GCNGC 4 cut(s) 517, 962, 1187, 1224
PleI GAGTC 1 cut(s) 722
PpsI GAGTC 1 cut(s) 722
PpuMI RGGWCCY 1 cut(s) 421
PscI ACATGT 2 cut(s) 330, 1144
PshBI ATTAAT 1 cut(s) 1205
PsiI TTATAA 1 cut(s) 1181
Psp5II RGGWCCY 1 cut(s) 421
PspN4I GGNNCC 1 cut(s) 627
PspPI GGNCC 1 cut(s) 421
PspPPI RGGWCCY 1 cut(s) 421
PstI CTGCAG 1 cut(s) 1190
PsuI RGATCY 2 cut(s) 520, 625
RsaI GTAC 3 cut(s) 107, 161, 1244
RsaNI GTAC 3 cut(s) 106, 160, 1243
RseI CAYNNNNRTG 2 cut(s) 292, 1041
SaqAI TTAA 6 cut(s) 47, 165, 525, 1047, 1091, 1205
SatI GCNGC 4 cut(s) 516, 961, 1186, 1223
Sau3AI GATC 5 cut(s) 52, 479, 520, 625, 985
Sau96I GGNCC 1 cut(s) 421
SchI GAGTC 1 cut(s) 722
SfaNI GCATC 5 cut(s) 220, 773, 862, 1025, 1148
SfcI CTRYAG 1 cut(s) 1186
SfuI TTCGAA 2 cut(s) 317, 1256
SinI GGWCC 1 cut(s) 421
SmiMI CAYNNNNRTG 2 cut(s) 292, 1041
SmlI CTYRAG 2 cut(s) 496, 939
SmoI CTYRAG 2 cut(s) 496, 939
Sse9I AATT 9 cut(s) 12, 77, 220, 633, 812, 841, 847, 950, 970
SsiI CCGC 4 cut(s) 518, 961, 992, 1223
SspI AATATT 1 cut(s) 893
SspMI CTAG 3 cut(s) 989, 1301, 1318
StyI CCWWGG 2 cut(s) 345, 964
TaaI ACNGT 2 cut(s) 304, 687
TaiI ACGT 1 cut(s) 478
TaqI TCGA 5 cut(s) 36, 317, 478, 1201, 1256
TasI AATT 9 cut(s) 12, 77, 220, 633, 812, 841, 847, 950, 970
TauI GCSGC 2 cut(s) 963, 1225
TfiI GAWTC 5 cut(s) 250, 314, 464, 907, 1258
Tru1I TTAA 6 cut(s) 47, 165, 525, 1047, 1091, 1205
Tru9I TTAA 6 cut(s) 47, 165, 525, 1047, 1091, 1205
TscAI CASTG 2 cut(s) 148, 690
TseFI GTSAC 1 cut(s) 646
TseI GCWGC 2 cut(s) 515, 1185
Tsp45I GTSAC 1 cut(s) 646
TspDTI ATGAA 4 cut(s) 743, 792, 797, 869
TspGWI ACGGA 1 cut(s) 836
TspRI CASTG 2 cut(s) 148, 690
VpaK11BI GGWCC 1 cut(s) 421
VspI ATTAAT 1 cut(s) 1205
XapI RAATTY 2 cut(s) 12, 77
XceI RCATGY 3 cut(s) 334, 386, 1148
XmiI GTMKAC 3 cut(s) 531, 945, 1311
XmnI GAANNNNTTC 2 cut(s) 153, 1271
XspI CTAG 3 cut(s) 989, 1301, 1318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.