Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000019.1

Orthogroup ID

OG0006943

Physical Location & Seq

Genomic Coordinates Reverse (-)

163854 .. 165008

Gene Structure 1155 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000019.1_g000033.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1155 bp

atggaattctcatcatgctaccttcctgaagaaatgatgatcgaaattcttctgaggctacccatcaagtctctccttcagttcacctctgtttccaaattttggaactcccttattaaacacaataccttcatcaaagaccacctcaaactcacttcaaacagaatcgccagagatggccctttgctccttctcaggcattgccccagagagcccaatgtagagcagtattctctacatttagacaaccacaccttccaagagtactcaaaaccacaacttacagctaagagcttcaatgagtgtttccgaattgtgggttcctgcaatggattaatcctcctctcagacgattacctgaccgagaccaataccttcgttctatggaacccctcaattcgaaagtccatcactcttcctaaacctcatatccgacactctcaatactatacagtttatgggtttgggtttgatgctaagaaagatgattacaagatagtgcagctggtgtatgaaggtcacaacagagctggccctgaagttgtgctctactcactcaattcagggtcttggaaagccattactgcagcttctcccaagcatgagattgctccgacaatgtggtctcaggtttttgttaatgggtttatccatttcatagggtattctaagaaaggagaagcttatgacaatgttgttttgggatttaatgtgtgtgaagaggtttttcatgagattaaaatgccaagggacttggcttctgaggtgccagacatggaactcattgcagttagtggcaagtcccttgctctgcaacactatgatagtaaacataagtgttgcaatgtatgggttatgagagagtatggtgtggtggagtcatggacaaagcaattctccattgattttctcaccccgaactttcgggtaacaaaggttttggggtctaggaagaatggtgaatttcttttagaaacgtataaagcaaagaagggagagatagtccttcatgatcccaagaaaaacacaaatgagcatcttggaatttatacagatccagggtacacaagtcttgaacattacatggaaagtctagttttgcttgataaagcaacttcatttgcagattccatggagcaagaagaggaagaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like FBA_1 FBA_3

Protein Analysis

384

Amino Acids

44.26

Weight (kDa)

6.25

Isoelectric Point (pI)

38.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006943)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g27880
malus_domestica	MD17G1227400.v1.1
prunus_persica	Prupe.3G110400_v2.0.a1 Prupe.3G110600_v2.0.a1
pyrus_communis	pycom17g24030 pycom17g24150
rosa_chinensis	RchiOBHm_Chr2g0131271 RchiOBHm_Chr2g0131321 RchiOBHm_Chr2g0131341
rosa_laevigata	RLG00000019177 RLG00000019179
rosa_multiflora	Rmu_co8362045.1_g000001 Rmu_ssc0000019.1_g000030 Rmu_ssc0000019.1_g000033 Rmu_ssc0000019.1_g000034
rosa_roxburghii	Rroxscaffold_2G00113090 Rroxscaffold_2G00113120
rosa_rugosa	Rorug02G0295800 Rorug02G0295900
rosa_samantha	Rh2AG349000 Rh2AG349100 Rh2AG349200 Rh2CG335000
rosa_wichuraiana	Rw2G028320 Rw2G028330 Rw2G028340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	622
AccB1I	GGYRCC	1 cut(s)	766
AccB7I	CCANNNNNTGG	1 cut(s)	102
AclWI	GGATC	2 cut(s)	1007, 1049
AcsI	RAATTY	5 cut(s)	5, 45, 98, 962, 1044
AcuI	CTGAAG	3 cut(s)	48, 62, 558
AfaI	GTAC	2 cut(s)	266, 1064
AfiI	CCNNNNNNNGG	2 cut(s)	102, 316
AgsI	TTSAA	3 cut(s)	159, 298, 1076
AjnI	CCWGG	1 cut(s)	1057
AluBI	AGCT	6 cut(s)	287, 294, 505, 530, 590, 683
AluI	AGCT	6 cut(s)	287, 294, 505, 530, 590, 683
Alw21I	GWGCWC	1 cut(s)	549
Alw26I	GTCTC	3 cut(s)	75, 359, 630
AlwI	GGATC	2 cut(s)	1007, 1049
AoxI	GGCC	2 cut(s)	178, 532
ApeKI	GCWGC	2 cut(s)	502, 587
ApoI	RAATTY	5 cut(s)	5, 45, 98, 962, 1044
AseI	ATTAAT	1 cut(s)	335
Asp700I	GAANNNNTTC	1 cut(s)	48
AspS9I	GGNCC	2 cut(s)	179, 533
AsuHPI	GGTGA	3 cut(s)	76, 904, 971
AsuII	TTCGAA	1 cut(s)	400
BaeI	ACNNNNGTAYC	2 cut(s)	1054, 1087
BanI	GGYRCC	1 cut(s)	766
BanII	GRGCYC	1 cut(s)	216
Bbv12I	GWGCWC	1 cut(s)	549
BbvI	GCAGC	2 cut(s)	514, 599
BccI	CCATC	3 cut(s)	71, 170, 416
BciT130I	CCWGG	1 cut(s)	1059
BcoDI	GTCTC	3 cut(s)	75, 359, 630
BfaI	CTAG	2 cut(s)	948, 1094
BfmI	CTRYAG	1 cut(s)	585
BisI	GCNGC	2 cut(s)	503, 588
BlsI	GCNGC	2 cut(s)	504, 589
BmcAI	AGTACT	1 cut(s)	266
Bme1390I	CCNGG	1 cut(s)	1059
BmgT120I	GGNCC	2 cut(s)	179, 533
BmiI	GGNNCC	3 cut(s)	322, 389, 768
BmrFI	CCNGG	1 cut(s)	1059
BmsI	GCATC	2 cut(s)	463, 1045
Bpu14I	TTCGAA	1 cut(s)	400
BsaI	GGTCTC	2 cut(s)	359, 630
BsaJI	CCNNGG	3 cut(s)	746, 1058, 1131
BsaXI	ACNNNNNCTCC	2 cut(s)	987, 1017
Bsc4I	CCNNNNNNNGG	2 cut(s)	102, 316
Bse3DI	GCAATG	4 cut(s)	199, 334, 783, 850
BseBI	CCWGG	1 cut(s)	1059
BseDI	CCNNGG	3 cut(s)	746, 1058, 1131
BseLI	CCNNNNNNNGG	2 cut(s)	102, 316
BseMI	GCAATG	4 cut(s)	199, 334, 783, 850
BseMII	CTCAG	5 cut(s)	44, 208, 360, 641, 753
BseRI	GAGGAG	1 cut(s)	332
BseXI	GCAGC	2 cut(s)	514, 599
BsgI	GTGCAG	1 cut(s)	521
BshFI	GGCC	2 cut(s)	180, 534
BshNI	GGYRCC	1 cut(s)	766
BsiHKAI	GWGCWC	1 cut(s)	549
BslFI	GGGAC	2 cut(s)	764, 787
BslI	CCNNNNNNNGG	2 cut(s)	102, 316
BsmAI	GTCTC	3 cut(s)	75, 359, 630
BsmFI	GGGAC	2 cut(s)	764, 787
BsnI	GGCC	2 cut(s)	180, 534
Bso31I	GGTCTC	2 cut(s)	359, 630
Bsp119I	TTCGAA	1 cut(s)	400
Bsp1286I	GDGCHC	2 cut(s)	216, 549
Bsp143I	GATC	3 cut(s)	39, 1012, 1054
Bsp19I	CCATGG	1 cut(s)	1131
BspANI	GGCC	2 cut(s)	180, 534
BspCNI	CTCAG	5 cut(s)	45, 207, 359, 640, 754
BspHI	TCATGA	2 cut(s)	730, 1009
BspLI	GGNNCC	3 cut(s)	322, 389, 768
BspMAI	CTGCAG	1 cut(s)	589
BspPI	GGATC	2 cut(s)	1007, 1049
BspT104I	TTCGAA	1 cut(s)	400
BspT107I	GGYRCC	1 cut(s)	766
BspTNI	GGTCTC	2 cut(s)	359, 630
BsrDI	GCAATG	4 cut(s)	199, 334, 783, 850
BssECI	CCNNGG	3 cut(s)	746, 1058, 1131
BssMI	GATC	3 cut(s)	39, 1012, 1054
BssT1I	CCWWGG	2 cut(s)	746, 1131
Bst2UI	CCWGG	1 cut(s)	1059
Bst4CI	ACNGT	1 cut(s)	454
Bst6I	CTCTTC	3 cut(s)	420, 714, 1137
BstBI	TTCGAA	1 cut(s)	400
BstC8I	GCNNGC	1 cut(s)	532
BstDEI	CTNAG	8 cut(s)	53, 194, 288, 346, 477, 627, 669, 762
BstDSI	CCRYGG	1 cut(s)	1131
BstKTI	GATC	3 cut(s)	42, 1015, 1057
BstMAI	GTCTC	3 cut(s)	75, 359, 630
BstMBI	GATC	3 cut(s)	39, 1012, 1054
BstMWI	GCNNNNNNNGC	1 cut(s)	584
BstNI	CCWGG	1 cut(s)	1059
BstSCI	CCNGG	1 cut(s)	1057
BstSFI	CTRYAG	1 cut(s)	585
BstV1I	GCAGC	2 cut(s)	514, 599
BstX2I	RGATCY	1 cut(s)	1054
BstYI	RGATCY	1 cut(s)	1054
BsuRI	GGCC	2 cut(s)	180, 534
BtgI	CCRYGG	1 cut(s)	1131
Cac8I	GCNNGC	1 cut(s)	532
CciI	TCATGA	2 cut(s)	730, 1009
Cfr13I	GGNCC	2 cut(s)	179, 533
Csp6I	GTAC	2 cut(s)	265, 1063
CviAII	CATG	8 cut(s)	15, 602, 731, 775, 882, 1010, 1084, 1132
CviQI	GTAC	2 cut(s)	265, 1063
DdeI	CTNAG	8 cut(s)	53, 194, 288, 346, 477, 627, 669, 762
DpnI	GATC	3 cut(s)	41, 1014, 1056
DpnII	GATC	3 cut(s)	39, 1012, 1054
DrdI	GACNNNNNNGTC	1 cut(s)	622
DseDI	GACNNNNNNGTC	1 cut(s)	622
Eam1104I	CTCTTC	3 cut(s)	420, 714, 1137
EarI	CTCTTC	3 cut(s)	420, 714, 1137
Eco130I	CCWWGG	2 cut(s)	746, 1131
Eco24I	GRGCYC	1 cut(s)	216
Eco31I	GGTCTC	2 cut(s)	359, 630
Eco57I	CTGAAG	3 cut(s)	48, 62, 558
EcoRI	GAATTC	1 cut(s)	5
EcoRII	CCWGG	1 cut(s)	1057
EcoT14I	CCWWGG	2 cut(s)	746, 1131
EcoT38I	GRGCYC	1 cut(s)	216
ErhI	CCWWGG	2 cut(s)	746, 1131
FaeI	CATG	8 cut(s)	18, 605, 734, 778, 885, 1013, 1087, 1135
FaqI	GGGAC	2 cut(s)	764, 787
FatI	CATG	8 cut(s)	14, 601, 730, 774, 881, 1009, 1083, 1131
Fnu4HI	GCNGC	2 cut(s)	503, 588
FriOI	GRGCYC	1 cut(s)	216
Fsp4HI	GCNGC	2 cut(s)	503, 588
FspBI	CTAG	2 cut(s)	948, 1094
GluI	GCNGC	2 cut(s)	503, 588
HaeIII	GGCC	2 cut(s)	180, 534
Hin1II	CATG	8 cut(s)	18, 605, 734, 778, 885, 1013, 1087, 1135
HindIII	AAGCTT	1 cut(s)	681
HinfI	GANTC	3 cut(s)	165, 878, 1127
HphI	GGTGA	3 cut(s)	76, 904, 971
Hpy166II	GTNNAC	3 cut(s)	84, 830, 1065
Hpy188I	TCNGA	6 cut(s)	54, 311, 349, 434, 615, 763
Hpy188III	TCNNGA	4 cut(s)	26, 731, 1010, 1073
Hpy8I	GTNNAC	3 cut(s)	84, 830, 1065
HpyAV	CCTTC	9 cut(s)	32, 86, 139, 200, 265, 385, 509, 985, 1016
HpyCH4III	ACNGT	1 cut(s)	454
HpyCH4IV	ACGT	1 cut(s)	977
HpyCH4V	TGCA	7 cut(s)	327, 502, 587, 788, 814, 843, 1124
HpyF10VI	GCNNNNNNNGC	1 cut(s)	584
HpyF3I	CTNAG	8 cut(s)	53, 194, 288, 346, 477, 627, 669, 762
HpySE526I	ACGT	1 cut(s)	977
Hsp92II	CATG	8 cut(s)	18, 605, 734, 778, 885, 1013, 1087, 1135
Kzo9I	GATC	3 cut(s)	39, 1012, 1054
LmnI	GCTCC	3 cut(s)	192, 616, 1135
Lsp1109I	GCAGC	2 cut(s)	514, 599
LweI	GCATC	2 cut(s)	463, 1045
MaeI	CTAG	2 cut(s)	948, 1094
MaeII	ACGT	1 cut(s)	977
MaeIII	GTNAC	2 cut(s)	518, 928
MalI	GATC	3 cut(s)	41, 1014, 1056
MboI	GATC	3 cut(s)	39, 1012, 1054
MboII	GAAGA	6 cut(s)	41, 41, 407, 731, 964, 1154
MflI	RGATCY	1 cut(s)	1054
MhlI	GDGCHC	2 cut(s)	216, 549
MluCI	AATT	9 cut(s)	5, 45, 98, 312, 396, 559, 893, 962, 1044
MlyI	GAGTC	1 cut(s)	887
MmeI	TCCRAC	2 cut(s)	457, 638
MroXI	GAANNNNTTC	1 cut(s)	48
MseI	TTAA	5 cut(s)	117, 335, 639, 708, 738
MspA1I	CMGCKG	1 cut(s)	505
MspR9I	CCNGG	1 cut(s)	1059
MvaI	CCWGG	1 cut(s)	1059
MwoI	GCNNNNNNNGC	1 cut(s)	584
NcoI	CCATGG	1 cut(s)	1131
NdeII	GATC	3 cut(s)	39, 1012, 1054
NlaIII	CATG	8 cut(s)	18, 605, 734, 778, 885, 1013, 1087, 1135
NlaIV	GGNNCC	3 cut(s)	322, 389, 768
NmuCI	GTSAC	1 cut(s)	518
NspV	TTCGAA	1 cut(s)	400
PagI	TCATGA	2 cut(s)	730, 1009
PdmI	GAANNNNTTC	1 cut(s)	48
PfeI	GAWTC	2 cut(s)	165, 1127
PflMI	CCANNNNNTGG	1 cut(s)	102
PkrI	GCNGC	2 cut(s)	504, 589
PleI	GAGTC	1 cut(s)	886
PpsI	GAGTC	1 cut(s)	886
PshBI	ATTAAT	1 cut(s)	335
Psp6I	CCWGG	1 cut(s)	1057
PspGI	CCWGG	1 cut(s)	1057
PspN4I	GGNNCC	3 cut(s)	322, 389, 768
PspPI	GGNCC	2 cut(s)	179, 533
PstI	CTGCAG	1 cut(s)	589
PsuI	RGATCY	1 cut(s)	1054
PvuII	CAGCTG	1 cut(s)	505
RsaI	GTAC	2 cut(s)	266, 1064
RsaNI	GTAC	2 cut(s)	265, 1063
SaqAI	TTAA	5 cut(s)	117, 335, 639, 708, 738
SatI	GCNGC	2 cut(s)	503, 588
Sau3AI	GATC	3 cut(s)	39, 1012, 1054
Sau96I	GGNCC	2 cut(s)	179, 533
ScaI	AGTACT	1 cut(s)	266
SchI	GAGTC	1 cut(s)	887
ScrFI	CCNGG	1 cut(s)	1059
SduI	GDGCHC	2 cut(s)	216, 549
SfaNI	GCATC	2 cut(s)	463, 1045
SfcI	CTRYAG	1 cut(s)	585
SfuI	TTCGAA	1 cut(s)	400
Sse9I	AATT	9 cut(s)	5, 45, 98, 312, 396, 559, 893, 962, 1044
SspMI	CTAG	2 cut(s)	948, 1094
StyD4I	CCNGG	1 cut(s)	1057
StyI	CCWWGG	2 cut(s)	746, 1131
TaaI	ACNGT	1 cut(s)	454
TaiI	ACGT	1 cut(s)	980
TaqI	TCGA	2 cut(s)	42, 400
TaqII	GACCGA	1 cut(s)	377
TasI	AATT	9 cut(s)	5, 45, 98, 312, 396, 559, 893, 962, 1044
TatI	WGTACW	1 cut(s)	264
TfiI	GAWTC	2 cut(s)	165, 1127
Tru1I	TTAA	5 cut(s)	117, 335, 639, 708, 738
Tru9I	TTAA	5 cut(s)	117, 335, 639, 708, 738
TseFI	GTSAC	1 cut(s)	518
TseI	GCWGC	2 cut(s)	502, 587
Tsp45I	GTSAC	1 cut(s)	518
TspDTI	ATGAA	6 cut(s)	121, 528, 646, 719, 998, 1107
Van91I	CCANNNNNTGG	1 cut(s)	102
VspI	ATTAAT	1 cut(s)	335
XapI	RAATTY	5 cut(s)	5, 45, 98, 962, 1044
XmnI	GAANNNNTTC	1 cut(s)	48
XspI	CTAG	2 cut(s)	948, 1094
ZrmI	AGTACT	1 cut(s)	266

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.