Rmu_ssc0000218.1_g000018

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000218.1
OG0005901
Physical Location & Seq
Forward (+)
76936 .. 77840
905 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 822 bp
atgagtgatgttacaagagcggatcttgatgctgttaccgcaacgtttaccgctgccatcaacaccgtgaacaatcagattggagaaatttgtggattgttagaagggaggaacaacaacaatagaatagaggcggggaaggaggctaacgagctagagctccacgtggtgatgttgttgagaacaattcagaatctgattccgaagaagaaattgtgcaacgtgaacaaccagtacaagctgaccaggattacaaagtcaaggctcatgaaattcctttcttttcaggcaacttgggcgtggaagattatctggattggcagctttaggtggatagattctttgagattatggagagaacatgagttagagttgtcaagcttggtgagcaagatgagggaagcaacatcgaaattcaatggtgacttggtgaccaagctccaaggtcaagatgggttagccactattagtaaggttttccaagacatggccgaggctatcacactctccactaatggggatgatcaggtggagatgaactttattgggtatgccagtattgcctactttggagtgtatgatgctgattttggcaggagaaagcctctgtgggtcgttccagttcatgagccctgtcacgaggccttttcggtcaatgtggttcgtttgatggatacaggagaatggggaaacaatggttttgaagcttggatttctctagctgaagaagaaatggcaatgttgcaaatcaatcaggacttgcttgcttttgcttctctcaatcctagccctcttagattaagccaaaatactgggtcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transferase

Protein Analysis

273

Amino Acids

30.82

Weight (kDa)

5.5

Isoelectric Point (pI)

27.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transferase PF02458 163 - 253 8.1e-06 Transferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 487
AccBSI CCGCTC 1 cut(s) 20
AciI CCGC 4 cut(s) 20, 39, 51, 134
AclI AACGTT 1 cut(s) 44
AclWI GGATC 1 cut(s) 30
AcoI YGGCCR 1 cut(s) 489
AcsI RAATTY 3 cut(s) 87, 272, 413
AcuI CTGAAG 1 cut(s) 744
AcvI CACGTG 1 cut(s) 166
AdeI CACNNNGTG 1 cut(s) 169
AfaI GTAC 1 cut(s) 236
AfiI CCNNNNNNNGG 2 cut(s) 487, 516
AgsI TTSAA 2 cut(s) 418, 704
AjnI CCWGG 1 cut(s) 245
AluBI AGCT 8 cut(s) 154, 160, 241, 324, 381, 439, 707, 722
AluI AGCT 8 cut(s) 154, 160, 241, 324, 381, 439, 707, 722
Alw21I GWGCWC 1 cut(s) 162
AlwI GGATC 1 cut(s) 30
AlwNI CAGNNNCTG 1 cut(s) 196
AoxI GGCC 2 cut(s) 489, 642
ApeKI GCWGC 2 cut(s) 53, 321
ApoI RAATTY 3 cut(s) 87, 272, 413
AspS9I GGNCC 1 cut(s) 816
AsuHPI GGTGA 4 cut(s) 181, 397, 434, 442
AvaII GGWCC 1 cut(s) 816
BanII GRGCYC 2 cut(s) 162, 633
BauI CACGAG 1 cut(s) 638
BbrPI CACGTG 1 cut(s) 166
Bbv12I GWGCWC 1 cut(s) 162
BbvI GCAGC 2 cut(s) 40, 333
BccI CCATC 3 cut(s) 65, 446, 664
BciT130I CCWGG 1 cut(s) 247
BciVI GTATCC 1 cut(s) 667
BclI TGATCA 1 cut(s) 523
BfaI CTAG 4 cut(s) 155, 719, 786, 820
BfuI GTATCC 1 cut(s) 667
BisI GCNGC 2 cut(s) 54, 322
BlsI GCNGC 2 cut(s) 55, 323
Bme1390I CCNGG 1 cut(s) 247
Bme18I GGWCC 1 cut(s) 816
BmgT120I GGNCC 1 cut(s) 816
BmiI GGNNCC 1 cut(s) 817
BmrFI CCNGG 1 cut(s) 247
BmrI ACTGGG 1 cut(s) 822
BmsI GCATC 2 cut(s) 19, 571
BmuI ACTGGG 1 cut(s) 822
BplI GAGNNNNNCTC 2 cut(s) 589, 621
BsaAI YACGTR 1 cut(s) 166
BsaJI CCNNGG 2 cut(s) 442, 492
Bsc4I CCNNNNNNNGG 2 cut(s) 487, 516
Bse1I ACTGG 4 cut(s) 232, 555, 620, 817
Bse3DI GCAATG 1 cut(s) 744
BseBI CCWGG 1 cut(s) 247
BseDI CCNNGG 2 cut(s) 442, 492
BseGI GGATG 1 cut(s) 526
BseLI CCNNNNNNNGG 2 cut(s) 487, 516
BseMI GCAATG 1 cut(s) 744
BseNI ACTGG 4 cut(s) 232, 555, 620, 817
BseXI GCAGC 2 cut(s) 40, 333
BshFI GGCC 2 cut(s) 491, 644
BsiHKAI GWGCWC 1 cut(s) 162
BslI CCNNNNNNNGG 2 cut(s) 487, 516
BsnI GGCC 2 cut(s) 491, 644
Bsp1286I GDGCHC 2 cut(s) 162, 633
Bsp143I GATC 2 cut(s) 22, 523
BspACI CCGC 4 cut(s) 20, 39, 51, 134
BspANI GGCC 2 cut(s) 491, 644
BspHI TCATGA 2 cut(s) 267, 625
BspLI GGNNCC 1 cut(s) 817
BspPI GGATC 1 cut(s) 30
BsrBI CCGCTC 1 cut(s) 20
BsrDI GCAATG 1 cut(s) 744
BsrI ACTGG 4 cut(s) 232, 555, 620, 817
BssECI CCNNGG 2 cut(s) 442, 492
BssMI GATC 2 cut(s) 22, 523
BssSI CACGAG 1 cut(s) 638
BssT1I CCWWGG 1 cut(s) 442
Bst2BI CACGAG 1 cut(s) 638
Bst2UI CCWGG 1 cut(s) 247
Bst4CI ACNGT 1 cut(s) 67
BstBAI YACGTR 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 765
BstDEI CTNAG 1 cut(s) 794
BstEII GGTNACC 1 cut(s) 430
BstF5I GGATG 1 cut(s) 526
BstKTI GATC 2 cut(s) 25, 526
BstMBI GATC 2 cut(s) 22, 523
BstMWI GCNNNNNNNGC 4 cut(s) 38, 296, 387, 560
BstNI CCWGG 1 cut(s) 247
BstPI GGTNACC 1 cut(s) 430
BstSCI CCNGG 1 cut(s) 245
BstV1I GCAGC 2 cut(s) 40, 333
BstX2I RGATCY 1 cut(s) 22
BstXI CCANNNNNNTGG 1 cut(s) 812
BstYI RGATCY 1 cut(s) 22
BsuI GTATCC 1 cut(s) 667
BsuRI GGCC 2 cut(s) 491, 644
BtsCI GGATG 1 cut(s) 526
Cac8I GCNNGC 1 cut(s) 765
CaiI CAGNNNCTG 1 cut(s) 196
CciI TCATGA 2 cut(s) 267, 625
Cfr13I GGNCC 1 cut(s) 816
Csp6I GTAC 1 cut(s) 235
CviAII CATG 4 cut(s) 268, 362, 487, 626
CviQI GTAC 1 cut(s) 235
DdeI CTNAG 1 cut(s) 794
DpnI GATC 2 cut(s) 24, 525
DpnII GATC 2 cut(s) 22, 523
DraIII CACNNNGTG 1 cut(s) 169
EaeI YGGCCR 1 cut(s) 489
Ecl136II GAGCTC 1 cut(s) 160
Eco130I CCWWGG 1 cut(s) 442
Eco147I AGGCCT 1 cut(s) 644
Eco24I GRGCYC 2 cut(s) 162, 633
Eco47I GGWCC 1 cut(s) 816
Eco53kI GAGCTC 1 cut(s) 160
Eco57I CTGAAG 1 cut(s) 744
Eco72I CACGTG 1 cut(s) 166
Eco91I GGTNACC 1 cut(s) 430
EcoICRI GAGCTC 1 cut(s) 160
EcoO109I RGGNCCY 1 cut(s) 816
EcoO65I GGTNACC 1 cut(s) 430
EcoRII CCWGG 1 cut(s) 245
EcoT14I CCWWGG 1 cut(s) 442
EcoT38I GRGCYC 2 cut(s) 162, 633
ErhI CCWWGG 1 cut(s) 442
FaeI CATG 4 cut(s) 271, 365, 490, 629
FaiI YATR 7 cut(s) 269, 352, 363, 488, 552, 579, 627
FatI CATG 4 cut(s) 267, 361, 486, 625
FauI CCCGC 1 cut(s) 127
FbaI TGATCA 1 cut(s) 523
Fnu4HI GCNGC 2 cut(s) 54, 322
FokI GGATG 1 cut(s) 533
FriOI GRGCYC 2 cut(s) 162, 633
Fsp4HI GCNGC 2 cut(s) 54, 322
FspBI CTAG 4 cut(s) 155, 719, 786, 820
GluI GCNGC 2 cut(s) 54, 322
HaeIII GGCC 2 cut(s) 491, 644
Hin1II CATG 4 cut(s) 271, 365, 490, 629
HindIII AAGCTT 2 cut(s) 379, 705
HinfI GANTC 3 cut(s) 193, 199, 338
HphI GGTGA 4 cut(s) 181, 397, 434, 442
Hpy166II GTNNAC 3 cut(s) 48, 70, 226
Hpy188I TCNGA 4 cut(s) 78, 192, 198, 204
Hpy188III TCNNGA 7 cut(s) 26, 268, 313, 449, 626, 638, 755
Hpy8I GTNNAC 3 cut(s) 48, 70, 226
HpyAV CCTTC 2 cut(s) 98, 133
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4IV ACGT 3 cut(s) 44, 165, 222
HpyCH4V TGCA 2 cut(s) 219, 745
HpyF10VI GCNNNNNNNGC 4 cut(s) 38, 296, 387, 560
HpyF3I CTNAG 1 cut(s) 794
HpySE526I ACGT 3 cut(s) 44, 165, 222
Hsp92II CATG 4 cut(s) 271, 365, 490, 629
Ksp22I TGATCA 1 cut(s) 523
Kzo9I GATC 2 cut(s) 22, 523
LmnI GCTCC 2 cut(s) 165, 444
Lsp1109I GCAGC 2 cut(s) 40, 333
LweI GCATC 2 cut(s) 19, 571
MaeI CTAG 4 cut(s) 155, 719, 786, 820
MaeII ACGT 3 cut(s) 44, 165, 222
MaeIII GTNAC 5 cut(s) 10, 34, 422, 430, 635
MalI GATC 2 cut(s) 24, 525
MbiI CCGCTC 1 cut(s) 20
MboI GATC 2 cut(s) 22, 523
MboII GAAGA 5 cut(s) 217, 220, 316, 737, 740
MflI RGATCY 1 cut(s) 22
MhlI GDGCHC 2 cut(s) 162, 633
MluCI AATT 5 cut(s) 87, 186, 212, 272, 413
MnlI CCTC 8 cut(s) 102, 124, 136, 390, 487, 615, 634, 801
MseI TTAA 1 cut(s) 800
MspA1I CMGCKG 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 247
MvaI CCWGG 1 cut(s) 247
MwoI GCNNNNNNNGC 4 cut(s) 38, 296, 387, 560
NdeII GATC 2 cut(s) 22, 523
NlaIII CATG 4 cut(s) 271, 365, 490, 629
NlaIV GGNNCC 1 cut(s) 817
NmeAIII GCCGAG 1 cut(s) 517
NmuCI GTSAC 3 cut(s) 422, 430, 635
PagI TCATGA 2 cut(s) 267, 625
PceI AGGCCT 1 cut(s) 644
PfeI GAWTC 3 cut(s) 193, 199, 338
PflMI CCANNNNNTGG 1 cut(s) 487
PkrI GCNGC 2 cut(s) 55, 323
PmaCI CACGTG 1 cut(s) 166
PmlI CACGTG 1 cut(s) 166
Ppu21I YACGTR 1 cut(s) 166
PpuMI RGGWCCY 1 cut(s) 816
Psp124BI GAGCTC 1 cut(s) 162
Psp1406I AACGTT 1 cut(s) 44
Psp5II RGGWCCY 1 cut(s) 816
Psp6I CCWGG 1 cut(s) 245
PspCI CACGTG 1 cut(s) 166
PspEI GGTNACC 1 cut(s) 430
PspGI CCWGG 1 cut(s) 245
PspN4I GGNNCC 1 cut(s) 817
PspPI GGNCC 1 cut(s) 816
PspPPI RGGWCCY 1 cut(s) 816
PsrI GAACNNNNNNTAC 2 cut(s) 218, 250
PstNI CAGNNNCTG 1 cut(s) 196
PsuI RGATCY 1 cut(s) 22
RsaI GTAC 1 cut(s) 236
RsaNI GTAC 1 cut(s) 235
SacI GAGCTC 1 cut(s) 162
SaqAI TTAA 1 cut(s) 800
SatI GCNGC 2 cut(s) 54, 322
Sau3AI GATC 2 cut(s) 22, 523
Sau96I GGNCC 1 cut(s) 816
ScrFI CCNGG 1 cut(s) 247
SduI GDGCHC 2 cut(s) 162, 633
SfaNI GCATC 2 cut(s) 19, 571
SinI GGWCC 1 cut(s) 816
Sse9I AATT 5 cut(s) 87, 186, 212, 272, 413
SseBI AGGCCT 1 cut(s) 644
SsiI CCGC 4 cut(s) 20, 39, 51, 134
SspMI CTAG 4 cut(s) 155, 719, 786, 820
SstI GAGCTC 1 cut(s) 162
StuI AGGCCT 1 cut(s) 644
StyD4I CCNGG 1 cut(s) 245
StyI CCWWGG 1 cut(s) 442
TaaI ACNGT 1 cut(s) 67
TaiI ACGT 3 cut(s) 47, 168, 225
TaqI TCGA 1 cut(s) 410
TaqII GACCGA 1 cut(s) 640
TasI AATT 5 cut(s) 87, 186, 212, 272, 413
TatI WGTACW 1 cut(s) 234
TfiI GAWTC 3 cut(s) 193, 199, 338
Tru1I TTAA 1 cut(s) 800
Tru9I TTAA 1 cut(s) 800
TseFI GTSAC 3 cut(s) 422, 430, 635
TseI GCWGC 2 cut(s) 53, 321
Tsp45I GTSAC 3 cut(s) 422, 430, 635
TspDTI ATGAA 3 cut(s) 284, 551, 614
Van91I CCANNNNNTGG 1 cut(s) 487
VpaK11BI GGWCC 1 cut(s) 816
XapI RAATTY 3 cut(s) 87, 272, 413
XcmI CCANNNNNNNNNTGG 1 cut(s) 449
XspI CTAG 4 cut(s) 155, 719, 786, 820
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.