Rroxscaffold_2G00114240

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0002692
Physical Location & Seq
Reverse (-)
40158160 .. 40158596
437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00114240.1

Sequence Viewer

Length: 348 bp
ATGGCTAGGGCAATTGCCGCTGTAGGTGATAGTGCTGATCATGTAGGTGGTCTTTTGCTACCAAGTAGTTCTGGAGAAAGGAAACTCCAAGAATATTGGTGGCCTCGACCAAAAGAAAAAAAGAATACTGGTGGCAGTAAAAACTATGGGGGTCCTGTGCGTGCGACTGGTATTTATGGAGTTGGCACTGCTAGTGGTGGTGATGGAGGTGGACATGGCCATGGTGGGCATGGTGGAGGCGGTGGTTGTGGAGGACACAGCGGTGGTGGAAATGATGGTGGCGGGGGTTGTGGTGGTGGAGGTTGCGGTGGTGGGGGTTGCGGTGGGGGCGGTTGTGGTGGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

10.47

Weight (kDa)

8.34

Isoelectric Point (pI)

40.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 7 cut(s) 18, 240, 261, 282, 306, 321, 330
AcoI YGGCCR 1 cut(s) 217
AleI CACNNNNGTG 1 cut(s) 261
AoxI GGCC 2 cut(s) 101, 217
AspS9I GGNCC 1 cut(s) 152
AsuHPI GGTGA 2 cut(s) 38, 212
AvaII GGWCC 1 cut(s) 152
BalI TGGCCA 1 cut(s) 219
BccI CCATC 2 cut(s) 197, 269
BclI TGATCA 1 cut(s) 37
BfaI CTAG 2 cut(s) 6, 192
BfmI CTRYAG 1 cut(s) 21
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme18I GGWCC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 152
BmiI GGNNCC 1 cut(s) 153
BpmI CTGGAG 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 220
Bse1I ACTGG 2 cut(s) 133, 172
BseDI CCNNGG 1 cut(s) 220
BseNI ACTGG 2 cut(s) 133, 172
BshFI GGCC 2 cut(s) 103, 219
BsnI GGCC 2 cut(s) 103, 219
Bsp143I GATC 1 cut(s) 37
Bsp19I CCATGG 1 cut(s) 220
BspACI CCGC 7 cut(s) 18, 240, 261, 282, 306, 321, 330
BspANI GGCC 2 cut(s) 103, 219
BspLI GGNNCC 1 cut(s) 153
BsrI ACTGG 2 cut(s) 133, 172
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 220
BstC8I GCNNGC 1 cut(s) 162
BstDSI CCRYGG 1 cut(s) 220
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 2 cut(s) 17, 327
BstSFI CTRYAG 1 cut(s) 21
BsuRI GGCC 2 cut(s) 103, 219
BtgI CCRYGG 1 cut(s) 220
BtsI GCAGTG 1 cut(s) 186
BtsIMutI CAGTG 1 cut(s) 186
Cac8I GCNNGC 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 152
CviAII CATG 4 cut(s) 41, 215, 221, 230
CviJI RGCY 3 cut(s) 5, 103, 219
CviKI_1 RGCY 3 cut(s) 5, 103, 219
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
EaeI YGGCCR 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 220
Eco47I GGWCC 1 cut(s) 152
EcoO109I RGGNCCY 1 cut(s) 152
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 4 cut(s) 44, 218, 224, 233
FaiI YATR 6 cut(s) 42, 147, 177, 216, 222, 231
FatI CATG 4 cut(s) 40, 214, 220, 229
FauI CCCGC 1 cut(s) 275
FbaI TGATCA 1 cut(s) 37
Fnu4HI GCNGC 1 cut(s) 18
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 2 cut(s) 6, 192
GluI GCNGC 1 cut(s) 18
GsuI CTGGAG 1 cut(s) 93
HaeIII GGCC 2 cut(s) 103, 219
Hin1II CATG 4 cut(s) 44, 218, 224, 233
HphI GGTGA 2 cut(s) 38, 212
Hpy166II GTNNAC 1 cut(s) 212
Hpy188III TCNNGA 1 cut(s) 72
Hpy8I GTNNAC 1 cut(s) 212
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 327
Hsp92II CATG 4 cut(s) 44, 218, 224, 233
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 4 cut(s) 57, 114, 153, 168
MaeI CTAG 2 cut(s) 6, 192
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MfeI CAATTG 1 cut(s) 12
MlsI TGGCCA 1 cut(s) 219
MluCI AATT 2 cut(s) 12, 343
MluNI TGGCCA 1 cut(s) 219
MnlI CCTC 5 cut(s) 114, 200, 230, 245, 293
Mox20I TGGCCA 1 cut(s) 219
MscI TGGCCA 1 cut(s) 219
MseI TTAA 1 cut(s) 346
MslI CAYNNNNRTG 3 cut(s) 45, 219, 261
Msp20I TGGCCA 1 cut(s) 219
MspA1I CMGCKG 2 cut(s) 20, 261
MunI CAATTG 1 cut(s) 12
MwoI GCNNNNNNNGC 2 cut(s) 17, 327
NcoI CCATGG 1 cut(s) 220
NdeII GATC 1 cut(s) 37
NlaIII CATG 4 cut(s) 44, 218, 224, 233
NlaIV GGNNCC 1 cut(s) 153
OliI CACNNNNGTG 1 cut(s) 261
PkrI GCNGC 1 cut(s) 19
PpuMI RGGWCCY 1 cut(s) 152
Psp5II RGGWCCY 1 cut(s) 152
PspN4I GGNNCC 1 cut(s) 153
PspPI GGNCC 1 cut(s) 152
PspPPI RGGWCCY 1 cut(s) 152
RseI CAYNNNNRTG 3 cut(s) 45, 219, 261
SaqAI TTAA 1 cut(s) 346
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 152
SetI ASST 4 cut(s) 28, 49, 211, 304
SfcI CTRYAG 1 cut(s) 21
SinI GGWCC 1 cut(s) 152
SmiMI CAYNNNNRTG 3 cut(s) 45, 219, 261
Sse9I AATT 2 cut(s) 12, 343
SsiI CCGC 7 cut(s) 18, 240, 261, 282, 306, 321, 330
SspI AATATT 1 cut(s) 95
SspMI CTAG 2 cut(s) 6, 192
StyI CCWWGG 1 cut(s) 220
TaqI TCGA 1 cut(s) 106
TasI AATT 2 cut(s) 12, 343
TauI GCSGC 1 cut(s) 20
Tru1I TTAA 1 cut(s) 346
Tru9I TTAA 1 cut(s) 346
TscAI CASTG 1 cut(s) 193
TspRI CASTG 1 cut(s) 193
VpaK11BI GGWCC 1 cut(s) 152
XcmI CCANNNNNNNNNTGG 1 cut(s) 227
XspI CTAG 2 cut(s) 6, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.