Rroxscaffold_2G00128750

50S ribosomal protein L21

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
64497972 .. 64502487
4516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00128750.1

Sequence Viewer

Length: 210 bp
ATGGCTAAAGGAGTTGGTTCACTCTGTCTTTGGGCATTAAGAAGAAACTCGATGGAGATTACGAGTCAATACTTATGGTTTAGTTGTATTGGAGGGCGCCAATACATTGATATACCTGGACAATATATCTATACACAGCGCCTCAAAGGAGCCAAGGTCAATGATAAGACTAGATTACATTCCAAGCCAAATCTAAATAGCAATGCCTAA

Protein Analysis

69

Amino Acids

7.86

Weight (kDa)

9.94

Isoelectric Point (pI)

31.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 96
AcyI GRCGYC 1 cut(s) 97
AjnI CCWGG 1 cut(s) 115
AspLEI GCGC 2 cut(s) 99, 141
BanI GGYRCC 1 cut(s) 96
BccI CCATC 1 cut(s) 46
BciT130I CCWGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 171
BfoI RGCGCY 2 cut(s) 100, 142
Bme1390I CCNGG 1 cut(s) 117
BmiI GGNNCC 2 cut(s) 98, 151
BmrFI CCNGG 1 cut(s) 117
BsaHI GRCGYC 1 cut(s) 97
BsaJI CCNNGG 1 cut(s) 153
BsaXI ACNNNNNCTCC 2 cut(s) 141, 171
Bse3DI GCAATG 1 cut(s) 208
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 153
BseMI GCAATG 1 cut(s) 208
BshNI GGYRCC 1 cut(s) 96
BspLI GGNNCC 2 cut(s) 98, 151
BspT107I GGYRCC 1 cut(s) 96
BsrDI GCAATG 1 cut(s) 208
BssECI CCNNGG 1 cut(s) 153
BssNI GRCGYC 1 cut(s) 97
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 117
BstACI GRCGYC 1 cut(s) 97
BstH2I RGCGCY 2 cut(s) 100, 142
BstHHI GCGC 2 cut(s) 99, 141
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 115
CfoI GCGC 2 cut(s) 99, 141
CviJI RGCY 3 cut(s) 5, 152, 187
CviKI_1 RGCY 3 cut(s) 5, 152, 187
DinI GGCGCC 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 153
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 153
EgeI GGCGCC 1 cut(s) 98
EheI GGCGCC 1 cut(s) 98
ErhI CCWWGG 1 cut(s) 153
FaiI YATR 4 cut(s) 76, 113, 126, 132
FspBI CTAG 1 cut(s) 171
GlaI GCGC 2 cut(s) 98, 140
HaeII RGCGCY 2 cut(s) 100, 142
HhaI GCGC 2 cut(s) 99, 141
Hin1I GRCGYC 1 cut(s) 97
Hin6I GCGC 2 cut(s) 97, 139
HinP1I GCGC 2 cut(s) 97, 139
HinfI GANTC 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 20
Hsp92I GRCGYC 1 cut(s) 97
HspAI GCGC 2 cut(s) 97, 139
KasI GGCGCC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 2 cut(s) 102, 129
MaeI CTAG 1 cut(s) 171
MboII GAAGA 1 cut(s) 54
Mly113I GGCGCC 1 cut(s) 97
MlyI GAGTC 1 cut(s) 73
MnlI CCTC 2 cut(s) 86, 152
MseI TTAA 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
NarI GGCGCC 1 cut(s) 97
NlaIV GGNNCC 2 cut(s) 98, 151
PleI GAGTC 1 cut(s) 72
PluTI GGCGCC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 2 cut(s) 98, 151
SaqAI TTAA 1 cut(s) 38
SchI GAGTC 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 117
SetI ASST 2 cut(s) 118, 159
SfoI GGCGCC 1 cut(s) 98
SgeI CNNG 7 cut(s) 61, 75, 128, 129, 166, 183, 196
SspDI GGCGCC 1 cut(s) 96
SspMI CTAG 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 1 cut(s) 153
TaqI TCGA 1 cut(s) 50
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.