Rh4DG023700

50S ribosomal protein L21

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
3823243 .. 3844772
21530 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG023700.1

Sequence Viewer

Length: 165 bp
ATGAACATATATTCAAGAGCATCGGCTGAAGGGAAACGCGTTCAGATTGGAGGGCGCCAATACATTGATATACCTGGACAATATATCTATACACAGCGCCTCAAAGGAGCCAAGGTCAATGATAAGACTTTTGGGATGAATGTGGTTAAACTTTATGGAACATAG

Protein Analysis

54

Amino Acids

6.1

Weight (kDa)

9.99

Isoelectric Point (pI)

14.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 54
AccII CGCG 1 cut(s) 39
AcuI CTGAAG 1 cut(s) 48
AcyI GRCGYC 1 cut(s) 55
AflIII ACRYGT 1 cut(s) 37
AgsI TTSAA 1 cut(s) 15
AjnI CCWGG 1 cut(s) 73
AspLEI GCGC 2 cut(s) 57, 99
BanI GGYRCC 1 cut(s) 54
BciT130I CCWGG 1 cut(s) 75
BfoI RGCGCY 2 cut(s) 58, 100
Bme1390I CCNGG 1 cut(s) 75
BmiI GGNNCC 2 cut(s) 56, 109
BmrFI CCNGG 1 cut(s) 75
BmsI GCATC 1 cut(s) 29
BsaHI GRCGYC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 111
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 141
Bsh1236I CGCG 1 cut(s) 39
BshNI GGYRCC 1 cut(s) 54
BspFNI CGCG 1 cut(s) 39
BspLI GGNNCC 2 cut(s) 56, 109
BspT107I GGYRCC 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 111
BssNI GRCGYC 1 cut(s) 55
BssT1I CCWWGG 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 75
BstACI GRCGYC 1 cut(s) 55
BstF5I GGATG 1 cut(s) 141
BstFNI CGCG 1 cut(s) 39
BstH2I RGCGCY 2 cut(s) 58, 100
BstHHI GCGC 2 cut(s) 57, 99
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstUI CGCG 1 cut(s) 39
BtsCI GGATG 1 cut(s) 141
CfoI GCGC 2 cut(s) 57, 99
CviJI RGCY 2 cut(s) 26, 110
CviKI_1 RGCY 2 cut(s) 26, 110
DinI GGCGCC 1 cut(s) 56
Eco130I CCWWGG 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 48
EcoRII CCWGG 1 cut(s) 73
EcoT14I CCWWGG 1 cut(s) 111
EgeI GGCGCC 1 cut(s) 56
EheI GGCGCC 1 cut(s) 56
ErhI CCWWGG 1 cut(s) 111
FaiI YATR 7 cut(s) 8, 10, 71, 84, 90, 156, 163
FokI GGATG 1 cut(s) 148
GlaI GCGC 2 cut(s) 56, 98
HaeII RGCGCY 2 cut(s) 58, 100
HhaI GCGC 2 cut(s) 57, 99
Hin1I GRCGYC 1 cut(s) 55
Hin6I GCGC 2 cut(s) 55, 97
HinP1I GCGC 2 cut(s) 55, 97
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 23
Hsp92I GRCGYC 1 cut(s) 55
HspAI GCGC 2 cut(s) 55, 97
KasI GGCGCC 1 cut(s) 54
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 2 cut(s) 60, 87
LweI GCATC 1 cut(s) 29
MluI ACGCGT 1 cut(s) 37
Mly113I GGCGCC 1 cut(s) 55
MnlI CCTC 2 cut(s) 44, 110
MseI TTAA 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
MvnI CGCG 1 cut(s) 39
NarI GGCGCC 1 cut(s) 55
NlaIV GGNNCC 2 cut(s) 56, 109
PluTI GGCGCC 1 cut(s) 58
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PspN4I GGNNCC 2 cut(s) 56, 109
SaqAI TTAA 1 cut(s) 147
ScrFI CCNGG 1 cut(s) 75
SetI ASST 2 cut(s) 76, 117
SfaNI GCATC 1 cut(s) 29
SfoI GGCGCC 1 cut(s) 56
SgeI CNNG 5 cut(s) 27, 50, 86, 87, 124
SspDI GGCGCC 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 73
StyI CCWWGG 1 cut(s) 111
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspDTI ATGAA 2 cut(s) 17, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.